ORK01233

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01233

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01233
Clone name	ha04835
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of th ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
Symbol	ITGAM
cDNA sequence	DNA sequence (4669 bp) Predicted protein sequence (1165 aa)
HaloTag ORF Clone	FHC01233
Flexi ORF Clone	FXC01233
Description	Integrin alpha-M precursor (Cell surface glycoprotein MAC-1 alpha subunit) (CR-3 alpha chain) (Leukocyte adhesion receptor MO1) (Neutrophil adherence receptor) (CD11b antigen).

Features of the cloned cDNA sequence

Description

Length: 4669 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1169 bp
Genome contig ID	gi51511732f_31078846
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- GCATCAATGCTGAGTTAATAAATCAAATATATGTC
Flanking genome sequence (172846 - 172895)	----+--------+--------+--------+--------+----* ATTTTTGCATATATGTAAGGATAATTTATAGGATATGTTCCTGGAAGTTT

Features of the protein sequence

Description

Length: 1165 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
P11215	100.0	Integrin alpha-...	Homo sapiens
EAW52144	99.9	integrin, alpha...	Homo sapiens
AAH96346	99.9	Integrin, alpha...	Homo sapiens
AAA59491	99.9	leukocyte adhes...	Homo sapiens
AAA59544	99.9	glycoprotein Ma...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002035	162	179	PR00453	von Willebrand factor
	IPR002035	199	213	PR00453	von Willebrand factor
	IPR002035	265	273	PR00453	von Willebrand factor
	IPR000413	414	426	PR01185	Integrins alpha chain
	IPR000413	431	442	PR01185	Integrins alpha chain
	IPR000413	463	483	PR01185	Integrins alpha chain
	IPR000413	532	556	PR01185	Integrins alpha chain
	IPR000413	596	617	PR01185	Integrins alpha chain
	IPR000413	621	640	PR01185	Integrins alpha chain
	IPR000413	737	750	PR01185	Integrins alpha chain
	IPR000413	1129	1148	PR01185	Integrins alpha chain
HMMPfam	IPR002035	163	341	PF00092	von Willebrand factor
	IPR013517	470	507	PF01839	FG-GAP
	IPR013517	534	568	PF01839	FG-GAP
	IPR013649	627	1045	PF08441	Integrin alpha-2
	IPR013513	1142	1156	PF00357	Integrin alpha chain
HMMSmart	IPR013519	43	93	SM00191	Integrin alpha beta-propellor
	IPR002035	161	346	SM00327	von Willebrand factor
	IPR013519	413	462	SM00191	Integrin alpha beta-propellor
	IPR013519	466	523	SM00191	Integrin alpha beta-propellor
	IPR013519	529	583	SM00191	Integrin alpha beta-propellor
	IPR013519	592	646	SM00191	Integrin alpha beta-propellor
ProfileScan	IPR002035	163	341	PS50234	von Willebrand factor
ScanRegExp	IPR013513	1141	1148	PS00242	Integrin alpha chain

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	8	FWLLPAMALRVLLLTALTLCHGF	30	SECONDARY	23
SOSUI2	2	1120	PLIVGSSVGGLLLLALITAALYK	1142	PRIMARY	23