Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01235
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB208801
Product ID ORK01235
Clone name hj01412
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol LTBP1
cDNA sequence DNA sequence (4940 bp)
Predicted protein sequence (1348 aa)
Flexi ORF Clone FXC01235
Description Latent-transforming growth factor beta-binding protein, isoform 1L precursor (LTBP-1) (Transforming growth factor beta-1-binding protein 1) (TGF-beta1-BP-1).
Features of the cloned cDNA sequence

Length: 4940 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 812 bp
Genome contig ID gi89161199f_33113210
PolyA signal sequence
(AATAAA,-21)		 
+----*----+----*----+----*----+----
ACCATTGTATGTTAAATAAATCACCATTTTTGTAG
Flanking genome sequence
(364720 - 364769)		 
----+----*----+----*----+----*----+----*----+----*
AAAAAATTCTACCTGAGAGTAATTGTCAATGAGTACATGTGTATAAGTTG

Features of the protein sequence

Length: 1348 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92038 0 100.0 latent transfor...
 Homo sapiens
BAG10593 0 100.0 latent-transfor...
 synthetic construct
XP_001165319 0 99.3 latent transfor...
 Pan troglodytes
AAI51355 0 92.7 LTBP1 protein [...
 Bos taurus
CAM24103 0 91.8 latent transfor...
 Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR006209 83 110 PF00008 EGF-like
IPR002212 246 289 PF00683 Matrix fibril-associated
IPR013091 306 345 PF07645 EGF calcium-binding
IPR002212 367 403 PF00683 Matrix fibril-associated
IPR006209 504 540 PF00008 EGF-like
IPR013091 542 582 PF07645 EGF calcium-binding
IPR013091 584 623 PF07645 EGF calcium-binding
IPR013091 625 663 PF07645 EGF calcium-binding
IPR013091 665 704 PF07645 EGF calcium-binding
IPR013091 706 745 PF07645 EGF calcium-binding
IPR013091 747 786 PF07645 EGF calcium-binding
IPR013091 788 827 PF07645 EGF calcium-binding
IPR013091 829 869 PF07645 EGF calcium-binding
IPR013091 871 911 PF07645 EGF calcium-binding
IPR002212 984 1027 PF00683 Matrix fibril-associated
IPR006209 1098 1133 PF00008 EGF-like
IPR002212 1161 1203 PF00683 Matrix fibril-associated
IPR006209 1252 1287 PF00008 EGF-like
IPR013091 1289 1332 PF07645 EGF calcium-binding
HMMSmart IPR006210 82 111 SM00181 EGF
IPR001881 306 346 SM00179 EGF-like calcium-binding
IPR006210 309 346 SM00181 EGF
IPR001881 500 541 SM00179 EGF-like calcium-binding
IPR006210 503 541 SM00181 EGF
IPR001881 542 583 SM00179 EGF-like calcium-binding
IPR006210 545 583 SM00181 EGF
IPR001881 584 624 SM00179 EGF-like calcium-binding
IPR006210 587 624 SM00181 EGF
IPR001881 625 664 SM00179 EGF-like calcium-binding
IPR006210 628 664 SM00181 EGF
IPR001881 665 705 SM00179 EGF-like calcium-binding
IPR006210 668 705 SM00181 EGF
IPR001881 706 746 SM00179 EGF-like calcium-binding
IPR006210 709 746 SM00181 EGF
IPR001881 747 787 SM00179 EGF-like calcium-binding
IPR006210 750 787 SM00181 EGF
IPR001881 788 828 SM00179 EGF-like calcium-binding
IPR006210 791 828 SM00181 EGF
IPR001881 829 870 SM00179 EGF-like calcium-binding
IPR006210 832 870 SM00181 EGF
IPR001881 871 912 SM00179 EGF-like calcium-binding
IPR006210 874 912 SM00181 EGF
IPR001881 913 955 SM00179 EGF-like calcium-binding
IPR006210 916 955 SM00181 EGF
IPR001881 1051 1093 SM00179 EGF-like calcium-binding
IPR006210 1054 1093 SM00181 EGF
IPR001881 1094 1134 SM00179 EGF-like calcium-binding
IPR006210 1097 1134 SM00181 EGF
IPR001881 1248 1288 SM00179 EGF-like calcium-binding
IPR006210 1251 1288 SM00181 EGF
IPR001881 1289 1333 SM00179 EGF-like calcium-binding
IPR006210 1292 1333 SM00181 EGF
ProfileScan IPR000742 79 111 PS50026 EGF-like
IPR000742 306 343 PS50026 EGF-like
IPR000742 500 537 PS50026 EGF-like
IPR000742 542 583 PS50026 EGF-like
IPR000742 665 705 PS50026 EGF-like
IPR000742 706 746 PS50026 EGF-like
IPR000742 747 787 PS50026 EGF-like
IPR000742 788 828 PS50026 EGF-like
IPR000742 829 870 PS50026 EGF-like
IPR000742 871 908 PS50026 EGF-like
IPR000742 1094 1130 PS50026 EGF-like
IPR000742 1248 1284 PS50026 EGF-like
IPR000742 1289 1333 PS50026 EGF-like
ScanRegExp IPR013032 99 110 PS00022 EGF-like region
IPR001881 306 330 PS01187 EGF-like calcium-binding
IPR000152 321 332 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 330 345 PS01186 EGF-like region
IPR001881 500 525 PS01187 EGF-like calcium-binding
IPR000152 516 527 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 525 540 PS01186 EGF-like region
IPR001881 542 567 PS01187 EGF-like calcium-binding
IPR000152 558 569 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 567 582 PS01186 EGF-like region
IPR001881 584 608 PS01187 EGF-like calcium-binding
IPR001881 625 649 PS01187 EGF-like calcium-binding
IPR001881 665 689 PS01187 EGF-like calcium-binding
IPR000152 680 691 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 689 704 PS01186 EGF-like region
IPR001881 706 730 PS01187 EGF-like calcium-binding
IPR000152 721 732 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 730 745 PS01186 EGF-like region
IPR001881 747 771 PS01187 EGF-like calcium-binding
IPR000152 762 773 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 771 786 PS01186 EGF-like region
IPR001881 788 813 PS01187 EGF-like calcium-binding
IPR000152 804 815 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 813 827 PS01186 EGF-like region
IPR001881 829 854 PS01187 EGF-like calcium-binding
IPR000152 845 856 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 854 869 PS01186 EGF-like region
IPR001881 871 896 PS01187 EGF-like calcium-binding
IPR000152 887 898 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 896 911 PS01186 EGF-like region
IPR001881 913 938 PS01187 EGF-like calcium-binding
IPR000152 929 940 PS00010 Aspartic acid and asparagine hydroxylation site
IPR001881 1051 1077 PS01187 EGF-like calcium-binding
IPR000152 1068 1079 PS00010 Aspartic acid and asparagine hydroxylation site
IPR001881 1094 1118 PS01187 EGF-like calcium-binding
IPR000152 1109 1120 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 1272 1287 PS01186 EGF-like region
IPR001881 1289 1317 PS01187 EGF-like calcium-binding
IPR000152 1308 1319 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 1317 1332 PS01186 EGF-like region
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp