ORK01239

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01239

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01239
Clone name	fk01475
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PRKAR2B
cDNA sequence	DNA sequence (3350 bp) Predicted protein sequence (437 aa)
HaloTag ORF Clone	FHC01239
Flexi ORF Clone	FXC01239
Description	cAMP-dependent protein kinase type II-beta regulatory subunit.

Features of the cloned cDNA sequence

Description

Length: 3350 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1918 bp
Genome contig ID	gi89161213f_106372474
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TAAATTTTCCTTACAATAAAGCACACTTTTATAAT
Flanking genome sequence (216708 - 216757)	----+--------+--------+--------+--------+----* AAAATACATGAATTATTGTTTTTCATACTTTTTTGCTTGTTTCTTTAAAG

Features of the protein sequence

Description

Length: 437 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAL24395	2.1e-168	100.0	protein kinase,...	Homo sapiens
XP_001148361	5e-168	96.7	cAMP-dependent ...	Pan troglodytes
P31323	8.1e-168	99.5	cAMP-dependent ...	Homo sapiens
AAH75800	1.1e-167	99.7	Protein kinase,...	Homo sapiens
EDL36899	2.8e-167	96.5	protein kinase,...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002373	194	208	PR00103	cAMP/cGMP-dependent protein kinase
	IPR002373	209	223	PR00103	cAMP/cGMP-dependent protein kinase
	IPR002373	367	376	PR00103	cAMP/cGMP-dependent protein kinase
	IPR002373	379	390	PR00103	cAMP/cGMP-dependent protein kinase
	IPR002373	400	412	PR00103	cAMP/cGMP-dependent protein kinase
HMMPfam	IPR003117	26	63	PF02197	cAMP-dependent protein kinase regulator
	IPR000595	191	280	PF00027	Cyclic nucleotide-binding
	IPR000595	313	409	PF00027	Cyclic nucleotide-binding
HMMSmart	IPR003117	26	63	SM00394	cAMP-dependent protein kinase regulator
	IPR000595	173	293	SM00100	Cyclic nucleotide-binding
	IPR000595	295	419	SM00100	Cyclic nucleotide-binding
ProfileScan	IPR000595	173	292	PS50042	Cyclic nucleotide-binding
ProfileScan	IPR000595	295	421	PS50042	Cyclic nucleotide-binding
ScanRegExp	IPR000595	200	216	PS00888	Cyclic nucleotide-binding
	IPR000595	240	257	PS00889	Cyclic nucleotide-binding
	IPR000595	322	338	PS00888	Cyclic nucleotide-binding
	IPR000595	369	386	PS00889	Cyclic nucleotide-binding

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp