ORK01241

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01241

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01241
Clone name	fk02065
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	BIRC2
cDNA sequence	DNA sequence (3722 bp) Predicted protein sequence (646 aa)
HaloTag ORF Clone	FHC01241
Flexi ORF Clone	FXC01241
Description	Baculoviral IAP repeat-containing protein 2 (Inhibitor of apoptosis protein 2) (HIAP2) (HIAP-2) (C-IAP1) (TNFR2-TRAF-signaling complex protein 2) (IAP homolog B) (RING finger protein 48).

Features of the cloned cDNA sequence

Description

Length: 3722 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	486 bp
Genome contig ID	gi51511727f_101623196
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TTGTGAGAAACATCTCAATAAAGTGCTTTAAAAAG
Flanking genome sequence (131416 - 131465)	----+--------+--------+--------+--------+----* ATTGTGTTACCAGAATATTTTTTCTTTCCTGATTTAAAAAGTAATTTTCA

Features of the protein sequence

Description

Length: 646 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q13490	100.0	Baculoviral IAP...	Homo sapiens
XP_001152468	99.8	baculoviral IAP...	Pan troglodytes
BAG36235	99.6	unnamed protein...	Homo sapiens
XP_001097089	98.3	baculoviral IAP...	Macaca mulatta
AAC50372	99.3	inhibitor of ap...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001370	77	142	PF00653	Proteinase inhibitor I32
	IPR001370	215	279	PF00653	Proteinase inhibitor I32
	IPR001370	300	365	PF00653	Proteinase inhibitor I32
	IPR001315	486	570	PF00619	Caspase Recruitment
	IPR001841	599	633	PF00097	Zinc finger
HMMSmart	IPR001370	72	143	SM00238	Proteinase inhibitor I32
	IPR001370	210	280	SM00238	Proteinase inhibitor I32
	IPR001370	295	366	SM00238	Proteinase inhibitor I32
	IPR001315	481	569	SM00114	Caspase Recruitment
	IPR001841	599	633	SM00184	Zinc finger
ProfileScan	IPR001370	77	142	PS50143	Proteinase inhibitor I32
	IPR001370	215	279	PS50143	Proteinase inhibitor I32
	IPR001370	300	365	PS50143	Proteinase inhibitor I32
	IPR001315	481	571	PS50209	Caspase Recruitment
	IPR001841	599	634	PS50089	Zinc finger
ScanRegExp	IPR001370	74	141	PS01282	Proteinase inhibitor I32
	IPR001370	212	278	PS01282	Proteinase inhibitor I32
	IPR001370	297	364	PS01282	Proteinase inhibitor I32

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp