Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01242
Order Kazusa clone(s) from : Japan || Other countries
Accession No AK226051
Product ID ORK01242
Clone name fk02491
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol JUP
cDNA sequence DNA sequence (3483 bp)
Predicted protein sequence (781 aa)
Flexi ORF Clone FXC01242
Description Junction plakoglobin (Desmoplakin-3) (Desmoplakin III) (Catenin gamma).
Features of the cloned cDNA sequence

Length: 3483 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1135 bp
Genome contig ID gi51511734r_37064387
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
AGACCAAAGCAAAGAAAATAAAAATAACACAGATG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CGTTGGAGGCTGTTTAGGGGAGTGGGGTGGGAAAGTTGAGGGGCTTCCCT

Features of the protein sequence

Length: 781 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAH00441 0 100.0 JUP protein [Ho...
Homo sapiens
AAH11865 0 100.0 JUP protein [Ho...
Homo sapiens
CAA92522 0 99.8 plakoglobin [Ho...
Homo sapiens
XP_001107394 0 99.7 similar to junc...
Macaca mulatta
AAO85780 0 99.8 gamma-catenin [...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR013284 114 134 PR01869 Beta-catenin
IPR013284 147 161 PR01869 Beta-catenin
IPR013284 198 219 PR01869 Beta-catenin
IPR013284 262 281 PR01869 Beta-catenin
IPR013284 318 340 PR01869 Beta-catenin
IPR013284 348 372 PR01869 Beta-catenin
IPR013284 472 497 PR01869 Beta-catenin
IPR013284 516 537 PR01869 Beta-catenin
IPR013284 631 653 PR01869 Beta-catenin
HMMPfam IPR000357 173 209 PF02985 HEAT
IPR000225 251 291 PF00514 Armadillo
IPR000225 377 417 PF00514 Armadillo
IPR000225 418 456 PF00514 Armadillo
IPR000225 458 500 PF00514 Armadillo
IPR000225 609 649 PF00514 Armadillo
IPR000225 650 690 PF00514 Armadillo
HMMSmart IPR000225 168 207 SM00185 Armadillo
IPR000225 208 250 SM00185 Armadillo
IPR000225 251 291 SM00185 Armadillo
IPR000225 292 333 SM00185 Armadillo
IPR000225 335 376 SM00185 Armadillo
IPR000225 377 417 SM00185 Armadillo
IPR000225 418 456 SM00185 Armadillo
IPR000225 458 500 SM00185 Armadillo
IPR000225 505 546 SM00185 Armadillo
IPR000225 547 608 SM00185 Armadillo
IPR000225 609 649 SM00185 Armadillo
IPR000225 650 690 SM00185 Armadillo
ProfileScan IPR000225 178 216 PS50176 Armadillo
IPR000225 220 263 PS50176 Armadillo
IPR000225 262 304 PS50176 Armadillo
IPR000225 304 346 PS50176 Armadillo
IPR000225 346 389 PS50176 Armadillo
IPR000225 427 469 PS50176 Armadillo
IPR000225 469 511 PS50176 Armadillo
IPR000225 516 559 PS50176 Armadillo
IPR000225 620 662 PS50176 Armadillo
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp