ORK01243

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01243

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01243
Clone name	fk05477
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	WEE1
cDNA sequence	DNA sequence (3323 bp) Predicted protein sequence (725 aa)
HaloTag ORF Clone	FHC01243
Flexi ORF Clone	FXC01243
Description	WEE1 homolog (S. pombe)

Features of the cloned cDNA sequence

Description

Length: 3323 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1145 bp
Genome contig ID	gi51511727f_9451820
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- ACATTGATTGGCATATTAAAAGTCACTCTGAGCTT
Flanking genome sequence (116056 - 116105)	----+--------+--------+--------+--------+----* ACCTTAATTGTCTAAATCCTTGTGATGCCTGTTTTCTAATATTTTATCTC

Features of the protein sequence

Description

Length: 725 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P30291	4.5e-200	100.0	Wee1-like prote...	Homo sapiens
CAA43979	8.7e-200	99.8	Wee1 Hu [Homo s...	Homo sapiens
AAH70052	1.1e-199	99.8	WEE1 homolog (S...	Homo sapiens
XP_521839	2.1e-199	99.5	wee1 tyrosine k...	Pan troglodytes
AAH51831	2.9e-199	99.8	WEE1 homolog (S...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	381	639	PD000001	Protein kinase
HMMPfam	IPR000719	378	648	PF00069	Protein kinase
HMMSmart	IPR001245	378	648	SM00219	Tyrosine protein kinase
HMMSmart	IPR002290	378	648	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	378	648	PS50011	Protein kinase
ScanRegExp	IPR000719	384	407	PS00107	Protein kinase
ScanRegExp	IPR008271	501	513	PS00108	Serine/threonine protein kinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp