ORK01244

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01244

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01244
Clone name	fk05513
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	HNRNPUL1
cDNA sequence	DNA sequence (3514 bp) Predicted protein sequence (900 aa)
HaloTag ORF Clone	FHC01244
Flexi ORF Clone	FXC01244
Description	Heterogeneous nuclear ribonucleoprotein U-like protein 1 (Adenovirus early region 1B-associated protein 5) (E1B-55 kDa-associated protein 5) (E1B-AP5).

Features of the cloned cDNA sequence

Description

Length: 3514 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	810 bp
Genome contig ID	gi42406306f_46362249
PolyA signal sequence (None)	+--------+--------+----*----+---- ATTTGGAGAGAGTGACTATTGAACTTGAAACCTTT
Flanking genome sequence (142873 - 142922)	----+--------+--------+--------+--------+----* TATTCCGGGCGTCTTGGTAGTTTCTGGTGGGATTCAGTGGGTGAGAGGGA

Features of the protein sequence

Description

Length: 900 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9BUJ2	100.0	Heterogeneous n...	Homo sapiens
XP_001149509	99.8	similar to E1B-...	Pan troglodytes
BAF84451	99.8	unnamed protein...	Homo sapiens
AAH02564	99.8	Heterogeneous n...	Homo sapiens
XP_001149299	99.5	similar to E1B-...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	NULL	735	747	PR01217	NULL
	NULL	751	767	PR01217	NULL
	NULL	787	799	PR01217	NULL
	NULL	814	835	PR01217	NULL
	NULL	840	856	PR01217	NULL
HMMPfam	IPR003034	47	81	PF02037	DNA-binding SAP
HMMPfam	IPR003877	298	431	PF00622	SPla/RYanodine receptor SPRY
HMMSmart	IPR003034	47	81	SM00513	DNA-binding SAP
HMMSmart	IPR003877	298	431	SM00449	SPla/RYanodine receptor SPRY
ProfileScan	IPR003034	47	81	PS50800	DNA-binding SAP
ProfileScan	IPR001870	235	432	PS50188	B302

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp