Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01246
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01246
Clone name he00358
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol TFIP11
cDNA sequence DNA sequence (2835 bp)
Predicted protein sequence (839 aa)
Flexi ORF Clone FXC01246
Description Tuftelin-interacting protein 11.
Features of the cloned cDNA sequence

Length: 2835 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 82 bp
Genome contig ID gi89161203r_25117897
PolyA signal sequence
(AATAAA,-27)
+----*----+----*----+----*----+----
GTACTGTAAATAAACAGTATTTTTAGATCACCTTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAGGGTAACTTCTTTACTCAGGAGCTACTCCACATCAGGCCAGGTCAT

Features of the protein sequence

Length: 839 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9UBB9 0 100.0 Tuftelin-intera...
Homo sapiens
A1XD93 0 99.8 Tuftelin-intera...
Pan troglodytes
A1XD94 0 99.8 Tuftelin-intera...
Macaca mulatta
AAH33080 0 99.8 Tuftelin intera...
Homo sapiens
CAL37965 0 99.8 hypothetical pr...
synthetic construct
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000467 151 195 PF01585 D111/G-patch
IPR014809 394 628 PF08697 Tuftelin interacting protein 11
HMMSmart IPR000467 149 195 SM00443 D111/G-patch
ProfileScan IPR000467 151 197 PS50174 D111/G-patch
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp