ORK01247

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01247

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01247
Clone name	hg00555
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	LMO4
cDNA sequence	DNA sequence (1686 bp) Predicted protein sequence (247 aa)
HaloTag ORF Clone	FHC01247
Flexi ORF Clone	FXC01247
Description	LIM domain transcription factor LMO4 (LIM domain only protein 4) (LMO- 4) (Breast tumor autoantigen).

Features of the cloned cDNA sequence

Description

Length: 1686 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	777 bp
Genome contig ID	gi89161185f_87467108
PolyA signal sequence (AATAAA,-16)	+--------+--------+----*----+---- TAGTATGGTGTATTTAAATAATAAAAACTTAAAAG
Flanking genome sequence (116737 - 116786)	----+--------+--------+--------+--------+----* AAAAAATATTTAATGGTGTTTGGGTTTAAACACTGCTTTTTCTCTTCTGT

Features of the protein sequence

Description

Length: 247 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P61968	7.7e-66	100.0	LIM domain tran...	Homo sapiens
AAM95988	2.8e-65	98.7	LIM domain only...	Gallus gallus
ABM85552	4.9e-65	100.0	LIM domain only...	synthetic construct
XP_001506631	5.4e-65	88.4	similar to brea...	Ornithorhynchus...
Q6DJ06	8.5e-65	98.1	LIM domain tran...	Xenopus (Silura...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001781	104	162	PD000094	Zinc finger
BlastProDom	IPR001781	169	222	PD000094	Zinc finger
HMMPfam	IPR001781	105	164	PF00412	Zinc finger
HMMPfam	IPR001781	169	225	PF00412	Zinc finger
HMMSmart	IPR001781	104	158	SM00132	Zinc finger
HMMSmart	IPR001781	168	222	SM00132	Zinc finger
ProfileScan	IPR001781	103	165	PS50023	Zinc finger
ProfileScan	IPR001781	167	229	PS50023	Zinc finger
ScanRegExp	IPR001781	105	139	PS00478	Zinc finger
ScanRegExp	IPR001781	169	204	PS00478	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp