Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01248
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01248
Clone name hh00096
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol LAMB1
cDNA sequence DNA sequence (5587 bp)
Predicted protein sequence (1811 aa)
Flexi ORF Clone FXC01248
Description Laminin subunit beta-1 precursor (Laminin B1 chain).
Features of the cloned cDNA sequence

Length: 5587 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 149 bp
Genome contig ID gi89161213r_107251483
PolyA signal sequence
(AATAAA,-23)		 
+----*----+----*----+----*----+----
TGTATGGAGTTAAATAAAGTACAGTGCTTTTGTAT
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
ATATTTTGGTGTACTTGTTACTTTCACTGATTGTTGATGAATCCCTTTTT

Features of the protein sequence

Length: 1811 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
P07942 0 100.0 Laminin subunit...
 Homo sapiens
EAL24388 0 99.9 laminin, beta 1...
 Homo sapiens
XP_001165635 0 99.6 laminin, beta 1...
 Pan troglodytes
EAW83423 0 99.9 laminin, beta 1...
 Homo sapiens
XP_001165596 0 99.2 laminin, beta 1...
 Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR002049 1072 1090 PR00011 EGF-like
IPR002049 1121 1139 PR00011 EGF-like
IPR002049 1140 1168 PR00011 EGF-like
IPR002049 1169 1187 PR00011 EGF-like
HMMPfam IPR008211 60 294 PF00055 Laminin
IPR002049 296 357 PF00053 EGF-like
IPR002049 360 420 PF00053 EGF-like
IPR002049 423 480 PF00053 EGF-like
IPR002049 483 532 PF00053 EGF-like
IPR002049 535 573 PF00053 EGF-like
IPR002049 798 843 PF00053 EGF-like
IPR002049 846 889 PF00053 EGF-like
IPR002049 892 939 PF00053 EGF-like
IPR002049 942 998 PF00053 EGF-like
IPR002049 1001 1050 PF00053 EGF-like
IPR002049 1053 1106 PF00053 EGF-like
IPR002049 1109 1154 PF00053 EGF-like
IPR002049 1157 1201 PF00053 EGF-like
HMMSmart IPR008211 54 294 SM00136 Laminin
IPR002049 296 357 SM00180 EGF-like
IPR002049 360 420 SM00180 EGF-like
IPR002049 423 480 SM00180 EGF-like
IPR002049 483 532 SM00180 EGF-like
IPR002049 535 579 SM00180 EGF-like
IPR002049 798 843 SM00180 EGF-like
IPR006210 799 844 SM00181 EGF
IPR002049 846 889 SM00180 EGF-like
IPR006210 847 890 SM00181 EGF
IPR002049 892 939 SM00180 EGF-like
IPR006210 900 940 SM00181 EGF
IPR002049 942 998 SM00180 EGF-like
IPR006210 943 981 SM00181 EGF
IPR002049 1001 1050 SM00180 EGF-like
IPR006210 1014 1051 SM00181 EGF
IPR002049 1053 1106 SM00180 EGF-like
IPR006210 1064 1091 SM00181 EGF
IPR006210 1092 1140 SM00181 EGF
IPR002049 1109 1154 SM00180 EGF-like
IPR002049 1157 1201 SM00180 EGF-like
IPR006210 1158 1202 SM00181 EGF
ProfileScan IPR008211 56 295 PS51117 Laminin
IPR002049 296 359 PS50027 EGF-like
IPR002049 360 422 PS50027 EGF-like
IPR002049 423 482 PS50027 EGF-like
IPR002049 483 534 PS50027 EGF-like
IPR002049 535 580 PS50027 EGF-like
IPR013015 574 792 PS51116 Laminin IV
IPR002049 798 845 PS50027 EGF-like
IPR002049 846 891 PS50027 EGF-like
IPR002049 892 941 PS50027 EGF-like
IPR002049 942 1000 PS50027 EGF-like
IPR002049 1001 1052 PS50027 EGF-like
IPR002049 1053 1108 PS50027 EGF-like
IPR002049 1109 1156 PS50027 EGF-like
IPR002049 1157 1203 PS50027 EGF-like
ScanRegExp IPR013032 323 334 PS00022 EGF-like region
IPR002049 323 357 PS01248 EGF-like
IPR002049 387 423 PS01248 EGF-like
IPR013032 451 462 PS00022 EGF-like region
IPR002049 451 485 PS01248 EGF-like
IPR013032 504 515 PS00022 EGF-like region
IPR002049 504 537 PS01248 EGF-like
IPR013032 554 565 PS00022 EGF-like region
IPR013032 817 828 PS00022 EGF-like region
IPR002049 817 848 PS01248 EGF-like
IPR002049 908 944 PS01248 EGF-like
IPR013032 969 980 PS00022 EGF-like region
IPR013032 969 983 PS01186 EGF-like region
IPR002049 969 1003 PS01248 EGF-like
IPR002049 1022 1055 PS01248 EGF-like
IPR013032 1079 1090 PS00022 EGF-like region
IPR002049 1079 1111 PS01248 EGF-like
IPR013032 1128 1139 PS00022 EGF-like region
IPR013032 1128 1142 PS01186 EGF-like region
IPR002049 1128 1159 PS01248 EGF-like
IPR013032 1176 1187 PS00022 EGF-like region
IPR002049 1176 1207 PS01248 EGF-like
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp