ORK01252

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01252

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01252
Clone name	fj02250
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was inserted at the NotI site of the vector. The 3' end of the cDNA was ligated with the SalI adapter (5'CGGACGCGTG GGTCGA3') and inserted at the SalI site of the vector.
Symbol	EPS15
cDNA sequence	DNA sequence (4247 bp) Predicted protein sequence (920 aa)
HaloTag ORF Clone	FHC01252
Flexi ORF Clone	FXC01252
Description	Epidermal growth factor receptor substrate 15 (Protein Eps15) (AF-1p protein).

Features of the cloned cDNA sequence

Description

Length: 4247 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1482 bp
Genome contig ID	gi89161185r_51493487
PolyA signal sequence (None)	+--------+--------+----*----+---- CAAAATATCCAATTCATTTCTTCTTGAAAAAAAAA
Flanking genome sequence (364022 - 363973)	----+--------+--------+--------+--------+----* GATTTGTAAAGTAACTTAACTGCATAGTGTCACTCACTGAAATCACTCTA

Features of the protein sequence

Description

Length: 920 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
P42566	100.0	Epidermal growt...	Homo sapiens
AAA52101	99.8	epidermal growt...	Homo sapiens
XP_001139393	99.5	epidermal growt...	Pan troglodytes
EAX06822	99.6	epidermal growt...	Homo sapiens
EAX06824	98.5	epidermal growt...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002048	76	104	PF00036	Calcium-binding EF-hand
	IPR002048	188	216	PF00036	Calcium-binding EF-hand
	IPR002048	251	279	PF00036	Calcium-binding EF-hand
HMMSmart	IPR000261	32	127	SM00027	EPS15 homology (EH)
	IPR002048	76	104	SM00054	Calcium-binding EF-hand
	IPR000261	145	239	SM00027	EPS15 homology (EH)
	IPR002048	188	216	SM00054	Calcium-binding EF-hand
	IPR000261	241	337	SM00027	EPS15 homology (EH)
	IPR002048	251	279	SM00054	Calcium-binding EF-hand
	IPR003903	466	486	SM00726	Ubiquitin interacting motif
	IPR003903	875	894	SM00726	Ubiquitin interacting motif
	IPR003903	901	920	SM00726	Ubiquitin interacting motif
ProfileScan	IPR000261	39	128	PS50031	EPS15 homology (EH)
	IPR002048	72	107	PS50222	Calcium-binding EF-hand
	IPR000261	152	240	PS50031	EPS15 homology (EH)
	IPR002048	184	219	PS50222	Calcium-binding EF-hand
	IPR002048	247	282	PS50222	Calcium-binding EF-hand
	IPR000261	248	338	PS50031	EPS15 homology (EH)
	IPR002048	286	316	PS50222	Calcium-binding EF-hand
	IPR003903	875	894	PS50330	Ubiquitin interacting motif
	IPR003903	901	920	PS50330	Ubiquitin interacting motif
ScanRegExp	IPR002048	197	209	PS00018	Calcium-binding EF-hand
ScanRegExp	IPR002048	260	272	PS00018	Calcium-binding EF-hand

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp