ORK01254

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01254

Order Kazusa clone(s) from :

Accession No	AB208891
Product ID	ORK01254
Clone name	fj15254
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	NLRP3
cDNA sequence	DNA sequence (4008 bp) Predicted protein sequence (983 aa)
HaloTag ORF Clone	FHC01254
Flexi ORF Clone	FXC01254
Description	NACHT, LRR and PYD domains-containing protein 3 (Cold autoinflammatory syndrome 1 protein) (Cryopyrin) (PYRIN-containing APAF1-like protein 1) (Angiotensin/vasopressin receptor AII/AVP-like).

Features of the cloned cDNA sequence

Description

Length: 4008 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	313 bp
Genome contig ID	gi89161185f_245547977
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- AATTAGCTCATTCAATAAAGCACTTTCTTTATTTT
Flanking genome sequence (130767 - 130816)	----+--------+--------+--------+--------+----* TCTCTTCTCTGTCTAACTTTCTTTTTCCTATCTTTTTTCTTCTTTGTTCT

Features of the protein sequence

Description

Length: 983 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92128	100.0	Cryopyrin delet...	Homo sapiens
BAG10616	100.0	NACHT, LRR and ...	synthetic construct
XP_001140951	98.6	cryopyrin isofo...	Pan troglodytes
AAI17212	93.7	NLRP3 protein [...	Homo sapiens
AAQ98889	93.7	cryopyrin delet...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	747	760	PR00019	Leucine-rich repeat
FPrintScan	IPR001611	801	814	PR00019	Leucine-rich repeat
HMMPfam	IPR004020	10	93	PF02758	Pyrin
	IPR007111	224	393	PF05729	NACHT nucleoside triphosphatase
	IPR001611	746	769	PF00560	Leucine-rich repeat
	IPR001611	803	829	PF00560	Leucine-rich repeat
	IPR001611	860	883	PF00560	Leucine-rich repeat
	IPR001611	917	937	PF00560	Leucine-rich repeat
HMMSmart	IPR003590	744	771	SM00368	Leucine-rich repeat
	IPR003590	773	800	SM00368	Leucine-rich repeat
	IPR003590	801	828	SM00368	Leucine-rich repeat
	IPR003590	830	857	SM00368	Leucine-rich repeat
	IPR003590	858	885	SM00368	Leucine-rich repeat
	IPR003590	887	914	SM00368	Leucine-rich repeat
	IPR003590	915	942	SM00368	Leucine-rich repeat
ProfileScan	IPR004020	5	97	PS50824	Pyrin
ProfileScan	IPR007111	224	540	PS50837	NACHT nucleoside triphosphatase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	407	EVLFTMCFIPLVCWIVCTGLKQQ	429	PRIMARY	23
SOSUI2	2	438	QTSKTTTAVYVFFLSSLLQPRGG	460	SECONDARY	23