ORK01255

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01255

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01255
Clone name	fj15283
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	TCF12
cDNA sequence	DNA sequence (4732 bp) Predicted protein sequence (710 aa)
HaloTag ORF Clone	FHC01255
Flexi ORF Clone	FXC01255
Description	Transcription factor 12 (Transcription factor HTF-4) (E-box-binding protein) (DNA-binding protein HTF4).

Features of the cloned cDNA sequence

Description

Length: 4732 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	2366 bp
Genome contig ID	gi51511731f_54898174
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- ATGTAGCAATAAATGTGCCATCTTTTTTTTAACAC
Flanking genome sequence (469829 - 469878)	----+--------+--------+--------+--------+----* AGTAAAATAGTGAGTTTTTTACATTTCTCTTTCTCAAATAATAATGTATT

Features of the protein sequence

Description

Length: 710 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH50556	100.0	Transcription f...	Homo sapiens
XP_510436	99.4	transcription f...	Pan troglodytes
XP_001500644	96.7	transcription f...	Equus caballus
EDL84152	96.0	rCG56579, isofo...	Rattus norvegicus
XP_001368224	95.8	similar to Tran...	Monodelphis dom...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001092	606	659	PF00010	Basic helix-loop-helix dimerisation region bHLH
HMMSmart	IPR001092	611	664	SM00353	Basic helix-loop-helix dimerisation region bHLH
ProfileScan	IPR001092	604	659	PS50888	Basic helix-loop-helix dimerisation region bHLH

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp