ORK01256

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01256

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01256
Clone name	fk00023
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	DTX1
cDNA sequence	DNA sequence (3530 bp) Predicted protein sequence (673 aa)
HaloTag ORF Clone	FHC01256
Flexi ORF Clone	FXC01256
Description	deltex homolog 1 (Drosophila)

Features of the cloned cDNA sequence

Description

Length: 3530 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1085 bp
Genome contig ID	gi89161190f_111879799
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- CACTGTGGGTGGAGAAATAAATGGTCTTTCTCCTC
Flanking genome sequence (140416 - 140465)	----+--------+--------+--------+--------+----* CTCGCCTGGTCTTTTCCTGCCAAGAGAGGGGTGGGTGGCTCTGTTCCTGG

Features of the protein sequence

Description

Length: 673 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q86Y01	6.8e-187	100.0	Protein deltex-...	Homo sapiens
AAC06246	4.1e-185	99.1	deltex [Homo sa...	Homo sapiens
XP_590470	7.9e-181	97.5	deltex homolog ...	Bos taurus
Q61010	1.7e-179	95.8	Protein deltex-...	Mus musculus
XP_001076559	2.3e-179	95.8	similar to Prot...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004170	68	147	PF02825	WWE
	IPR004170	148	224	PF02825	WWE
	IPR001841	464	524	PF00097	Zinc finger
HMMSmart	IPR004170	76	155	SM00678	WWE
	IPR004170	157	232	SM00678	WWE
	IPR001841	464	524	SM00184	Zinc finger
ProfileScan	IPR004170	67	147	PS50918	WWE
	IPR004170	148	224	PS50918	WWE
	IPR001841	464	525	PS50089	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp