ORK01257

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01257

Order Kazusa clone(s) from :

Accession No	AK226104
Product ID	ORK01257
Clone name	fk07692
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	MID1
cDNA sequence	DNA sequence (3351 bp) Predicted protein sequence (645 aa)
HaloTag ORF Clone	FHC01257
Flexi ORF Clone	FXC01257
Description	Midline-1 (EC 6.3.2.-) (Tripartite motif-containing protein 18) (Putative transcription factor XPRF) (Midin) (RING finger protein 59) (Midline 1 RING finger protein).

Features of the cloned cDNA sequence

Description

Length: 3351 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1242 bp
Genome contig ID	gi89161218r_10276166
PolyA signal sequence (AATAGA,-17)	+--------+--------+----*----+---- TAGTCTAGTATAGTTTACAATAGAGTTGTAAGACC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAATTCAAACTCGTTATTCAGGAACCTGCTTATAA

Features of the protein sequence

Description

Length: 645 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG10620	0	100.0	midline-1 [synt...	synthetic construct
XP_001092954	0	99.8	similar to midl...	Macaca mulatta
XP_856459	0	98.7	similar to midl...	Canis lupus fam...
BAG59690	4.1e-214	98.0	unnamed protein...	Homo sapiens
CAH89447	5.4e-206	99.4	hypothetical pr...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR003879	460	477	PR01407	Butyrophylin-like
	IPR003879	501	525	PR01407	Butyrophylin-like
	IPR003879	573	597	PR01407	Butyrophylin-like
	IPR003879	603	621	PR01407	Butyrophylin-like
HMMPfam	IPR001841	26	75	PF00097	Zinc finger
	IPR003961	362	455	PF00041	Fibronectin
	IPR003877	516	633	PF00622	SPla/RYanodine receptor SPRY
HMMSmart	IPR001841	26	75	SM00184	Zinc finger
	IPR000315	130	180	SM00336	Zinc finger
	IPR003649	197	323	SM00502	B-box
	IPR003961	360	450	SM00060	Fibronectin
	IPR003877	516	635	SM00449	SPla/RYanodine receptor SPRY
ProfileScan	IPR001841	26	76	PS50089	Zinc finger
	IPR003961	356	459	PS50853	Fibronectin
	IPR001870	444	637	PS50188	B302
ScanRegExp	IPR001841	41	50	PS00518	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp