Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01261
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01261
Clone name hk06194
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol MTMR6
cDNA sequence DNA sequence (4034 bp)
Predicted protein sequence (625 aa)
Flexi ORF Clone FXC01261
Description Myotubularin-related protein 6 (EC 3.1.3.-).
Features of the cloned cDNA sequence

Length: 4034 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 1959 bp
Genome contig ID gi51511729r_24619411
PolyA signal sequence
(ATTAAA,-18)
+----*----+----*----+----*----+----
TATATGATTTAAAGGTAATTAAATGTTCACATTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACTTTGAATGTTTTTCTTCTGGATAAAACAAATGGAATCAAGTTGTAGTT

Features of the protein sequence

Length: 625 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9Y217 0 100.0 Myotubularin-re...
Homo sapiens
CAI39897 0 99.8 myotubularin re...
Homo sapiens
XP_509591 0 99.6 myotubularin re...
Pan troglodytes
AAL01037 0 99.6 myotubularin re...
Homo sapiens
BAG37162 0 99.6 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR010569 157 273 PF06602 Myotubularin-related
HMMSmart IPR003595 266 434 SM00404 Protein-tyrosine phosphatase
ScanRegExp IPR000387 338 350 PS00383 Protein-tyrosine phosphatase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp