Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01262
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01262
Clone name sj09815
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol PLCG2
cDNA sequence DNA sequence (4263 bp)
Predicted protein sequence (1278 aa)
Flexi ORF Clone FXC01262
Description phospholipase C, gamma 2 (phosphatidylinositol-specific)
Features of the cloned cDNA sequence

Length: 4263 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 295 bp
Genome contig ID gi51511732f_80270408
PolyA signal sequence
(AATAAA,-22)		 
+----*----+----*----+----*----+----
CCAAACCTCATTGAATAAAAGCAATGAAAACCTTG
Flanking genome sequence
(278993 - 279042)		 
----+----*----+----*----+----*----+----*----+----*
ATCAATTAAGCCTTCTGTTGCACGACCTGTGCAGTGAACAGGATTTCTTT

Features of the protein sequence

Length: 1278 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92151 0 100.0 1-phosphatidyli...
 Homo sapiens
P16885 0 100.0 1-phosphatidyli...
 Homo sapiens
XP_001147944 0 99.6 phospholipase C...
 Pan troglodytes
AAH07565 0 99.8 PLCG2 protein [...
 Homo sapiens
XP_001111677 0 98.1 phospholipase C...
 Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR013841 336 487 PD001202 Phosphatidylinositol-specific phospholipase C
IPR000980 545 651 PD000093 SH2 motif
IPR000980 659 750 PD000093 SH2 motif
IPR001452 786 838 PD000066 Src homology-3
IPR013841 926 1063 PD001202 Phosphatidylinositol-specific phospholipase C
FPrintScan IPR001192 330 348 PR00390 Phosphoinositide-specific phospholipase C
IPR001192 356 376 PR00390 Phosphoinositide-specific phospholipase C
IPR001192 453 470 PR00390 Phosphoinositide-specific phospholipase C
IPR000980 659 673 PR00401 SH2 motif
IPR000980 679 689 PR00401 SH2 motif
IPR000980 702 712 PR00401 SH2 motif
IPR000980 722 736 PR00401 SH2 motif
IPR001452 785 795 PR00452 Src homology-3
IPR001452 799 814 PR00452 Src homology-3
IPR001452 828 840 PR00452 Src homology-3
IPR001192 995 1016 PR00390 Phosphoinositide-specific phospholipase C
IPR001192 1016 1034 PR00390 Phosphoinositide-specific phospholipase C
IPR001192 1166 1176 PR00390 Phosphoinositide-specific phospholipase C
HMMPfam IPR001849 35 144 PF00169 Pleckstrin-like
IPR000909 326 470 PF00388 Phosphatidylinositol-specific phospholipase C
IPR000980 545 630 PF00017 SH2 motif
IPR000980 659 733 PF00017 SH2 motif
IPR001452 785 840 PF00018 Src homology-3
IPR001711 942 1057 PF00387 Phosphatidylinositol-specific phospholipase C
IPR000008 1076 1165 PF00168 C2 calcium-dependent membrane targeting
HMMSmart IPR001849 34 146 SM00233 Pleckstrin-like
IPR000909 325 469 SM00148 Phosphatidylinositol-specific phospholipase C
IPR000980 543 636 SM00252 SH2 motif
IPR000980 657 739 SM00252 SH2 motif
IPR001452 785 841 SM00326 Src homology-3
IPR001849 802 923 SM00233 Pleckstrin-like
IPR001711 943 1057 SM00149 Phosphatidylinositol-specific phospholipase C
IPR000008 1075 1180 SM00239 C2 calcium-dependent membrane targeting
ProfileScan IPR001849 33 144 PS50003 Pleckstrin-like
IPR000909 325 469 PS50007 Phosphatidylinositol-specific phospholipase C
IPR000980 545 648 PS50001 SH2 motif
IPR000980 659 748 PS50001 SH2 motif
IPR001452 782 842 PS50002 Src homology-3
IPR001711 943 1057 PS50008 Phosphatidylinositol-specific phospholipase C
IPR000008 1072 1165 PS50004 C2 calcium-dependent membrane targeting
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp