ORK01263

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01263

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01263
Clone name	hk07427
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PCDHA9
cDNA sequence	DNA sequence (4595 bp) Predicted protein sequence (953 aa)
HaloTag ORF Clone	FHC01263
Flexi ORF Clone	FXC01263
Description	Protocadherin alpha 9 precursor (PCDH-alpha9).

Features of the cloned cDNA sequence

Description

Length: 4595 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1642 bp
Genome contig ID	gi51511721f_140108165
PolyA signal sequence (AGTAAA,-22)	+--------+--------+----*----+---- GTATGAAAGACACAGTAAAATTTCTTTCTTAAATC
Flanking genome sequence (263185 - 263234)	----+--------+--------+--------+--------+----* AAGATACTGGTGATTCAAGGAATTTTATTTATGGTCCAGCCAAGAGCCAT

Features of the protein sequence

Description

Length: 953 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9Y5H5	100.0	Protocadherin a...	Homo sapiens
EAW61994	99.6	hCG1982192, iso...	Homo sapiens
Q5DRE3	99.0	Protocadherin a...	Pan troglodytes
XP_001088201	95.7	protocadherin a...	Macaca mulatta
BAE43864	95.4	Protocadherin a...	Macaca fuscata

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002126	76	95	PR00205	Cadherin
	IPR002126	245	274	PR00205	Cadherin
	IPR002126	423	435	PR00205	Cadherin
	IPR002126	437	456	PR00205	Cadherin
	IPR002126	456	469	PR00205	Cadherin
	IPR002126	516	542	PR00205	Cadherin
	IPR002126	550	567	PR00205	Cadherin
HMMPfam	IPR013164	32	115	PF08266	Cadherin
	IPR002126	141	236	PF00028	Cadherin
	IPR002126	250	344	PF00028	Cadherin
	IPR002126	358	449	PF00028	Cadherin
	IPR002126	463	559	PF00028	Cadherin
	IPR002126	591	673	PF00028	Cadherin
HMMSmart	IPR002126	48	134	SM00112	Cadherin
	IPR002126	158	243	SM00112	Cadherin
	IPR002126	267	351	SM00112	Cadherin
	IPR002126	375	456	SM00112	Cadherin
	IPR002126	480	566	SM00112	Cadherin
	IPR002126	597	679	SM00112	Cadherin
ProfileScan	IPR002126	11	136	PS50268	Cadherin
	IPR002126	137	245	PS50268	Cadherin
	IPR002126	246	353	PS50268	Cadherin
	IPR002126	354	458	PS50268	Cadherin
	IPR002126	459	568	PS50268	Cadherin
	IPR002126	591	681	PS50268	Cadherin
ScanRegExp	IPR002126	124	134	PS00232	Cadherin
	IPR002126	233	243	PS00232	Cadherin
	IPR002126	341	351	PS00232	Cadherin
	IPR002126	446	456	PS00232	Cadherin
	IPR002126	556	566	PS00232	Cadherin

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	15	QPLLLSLLILAMWVVGSGQLHYS	37	PRIMARY	23
SOSUI2	2	701	VYLIIAICAVSSLLVLTLLLYTV	723	PRIMARY	23