ORK01265

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01265

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01265
Clone name	hh07616
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	HR
cDNA sequence	DNA sequence (5440 bp) Predicted protein sequence (1261 aa)
HaloTag ORF Clone	FHC01265
Flexi ORF Clone	FXC01265
Description	Protein hairless.

Features of the cloned cDNA sequence

Description

Length: 5440 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1279 bp
Genome contig ID	gi51511724r_21927879
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- TTTTTTTATTAAATAAAGTTTTTTATTATAAGGGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATATACTTTCAGAACATTCAGAAAATAAGAAAGTCACCTTCTAGCCCAT

Features of the protein sequence

Description

Length: 1261 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAC32258	100.0	putative single...	Homo sapiens
O43593	99.9	Protein hairless.	Homo sapiens
XP_519644	98.4	hairless protei...	Pan troglodytes
AAL56245	95.2	hairless [Macac...	Macaca mulatta
EAW63716	97.6	hairless homolo...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013129	1104	1212	PF02373	Transcription factor jumonji
HMMSmart	IPR003347	1018	1229	SM00558	Transcription factor jumonji/aspartyl beta-hydroxylase
ProfileScan	IPR003347	1018	1229	PS51184	Transcription factor jumonji/aspartyl beta-hydroxylase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp