ORK01267

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01267

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01267
Clone name	fj15914
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PCDHA1
cDNA sequence	DNA sequence (4589 bp) Predicted protein sequence (957 aa)
HaloTag ORF Clone	FHC01267
Flexi ORF Clone	FXC01267
Description	protocadherin alpha 1

Features of the cloned cDNA sequence

Description

Length: 4589 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1642 bp
Genome contig ID	gi51511721f_140045966
PolyA signal sequence (AGTAAA,-22)	+--------+--------+----*----+---- GTATGAAAGACACAGTAAAATTTCTTTCTTAAATC
Flanking genome sequence (325384 - 325433)	----+--------+--------+--------+--------+----* AAGATACTGGTGATTCAAGGAATTTTATTTATGGTCCAGCCAAGAGCCAT

Features of the protein sequence

Description

Length: 957 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9Y5I3	100.0	Protocadherin a...	Homo sapiens
EAW61991	99.7	hCG1982192, iso...	Homo sapiens
Q5DRF5	98.6	Protocadherin a...	Pan troglodytes
BAE43856	96.2	Protocadherin a...	Macaca fuscata
XP_001918099	88.0	similar to Prot...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002126	80	99	PR00205	Cadherin
	IPR002126	249	278	PR00205	Cadherin
	IPR002126	427	439	PR00205	Cadherin
	IPR002126	441	460	PR00205	Cadherin
	IPR002126	460	473	PR00205	Cadherin
	IPR002126	520	546	PR00205	Cadherin
	IPR002126	554	571	PR00205	Cadherin
HMMPfam	IPR013164	36	119	PF08266	Cadherin
	IPR002126	145	240	PF00028	Cadherin
	IPR002126	254	348	PF00028	Cadherin
	IPR002126	362	453	PF00028	Cadherin
	IPR002126	467	563	PF00028	Cadherin
	IPR002126	580	677	PF00028	Cadherin
HMMSmart	IPR002126	54	138	SM00112	Cadherin
	IPR002126	162	247	SM00112	Cadherin
	IPR002126	271	355	SM00112	Cadherin
	IPR002126	379	460	SM00112	Cadherin
	IPR002126	484	570	SM00112	Cadherin
	IPR002126	601	683	SM00112	Cadherin
ProfileScan	IPR002126	35	140	PS50268	Cadherin
	IPR002126	164	249	PS50268	Cadherin
	IPR002126	250	357	PS50268	Cadherin
	IPR002126	358	462	PS50268	Cadherin
	IPR002126	463	572	PS50268	Cadherin
	IPR002126	595	685	PS50268	Cadherin
ScanRegExp	IPR002126	128	138	PS00232	Cadherin
	IPR002126	237	247	PS00232	Cadherin
	IPR002126	345	355	PS00232	Cadherin
	IPR002126	450	460	PS00232	Cadherin
	IPR002126	560	570	PS00232	Cadherin

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	15	GLGARDLLLWLLLLAAWEVGSGQ	37	SECONDARY	23
SOSUI2	2	701	VDVNVYLIIAICAVSSLLVLTLL	723	PRIMARY	23