ORK01291

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01291

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01291
Clone name	ha02378
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of th ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
Symbol	TRERF1
cDNA sequence	DNA sequence (6729 bp) Predicted protein sequence (1201 aa)
HaloTag ORF Clone	FHC01291
Flexi ORF Clone	FXC01291
Description	transcriptional regulating factor 1

Features of the cloned cDNA sequence

Description

Length: 6729 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3103 bp
Genome contig ID	gi89161210r_42200958
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- AACAAATAAATAAAGATGTTTTATAGACTTGTCCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAGGTGCATTCCTTAAAAAAAAAAAAAAGAAAAAAAAAGGAAACTGG

Features of the protein sequence

Description

Length: 1201 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAD92528	100.0	transcriptional...	Homo sapiens
EDM18871	89.4	transcriptional...	Rattus norvegicus
CAB88206	99.8	rapa-1 [Homo sa...	Homo sapiens
CAD92527	98.9	transcriptional...	Homo sapiens
XP_864918	92.0	similar to tran...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	596	618	PF00096	Zinc finger
	IPR000949	780	838	PF01448	ELM2
	IPR014778	888	933	PF00249	Myb
	IPR007087	1014	1038	PF00096	Zinc finger
	IPR007087	1087	1109	PF00096	Zinc finger
HMMSmart	IPR015880	596	618	SM00355	Zinc finger
	IPR001005	887	935	SM00717	SANT
	IPR015880	1014	1038	SM00355	Zinc finger
	IPR015880	1087	1109	SM00355	Zinc finger
ProfileScan	IPR007087	596	623	PS50157	Zinc finger
	IPR000949	780	871	PS51156	ELM2
	IPR007087	1014	1043	PS50157	Zinc finger
	IPR007087	1087	1114	PS50157	Zinc finger
ScanRegExp	IPR007087	598	618	PS00028	Zinc finger
	IPR007087	1016	1038	PS00028	Zinc finger
	IPR007087	1089	1109	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	51	TLFSQLLRVSVLLGLFYLPFLWF	73	PRIMARY	23