ORK01295

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01295

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01295
Clone name	ha03243
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of th ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
Symbol	MEF2A
cDNA sequence	DNA sequence (3069 bp) Predicted protein sequence (499 aa)
HaloTag ORF Clone	FHC01295
Flexi ORF Clone	FXC01295
Description	myocyte enhancer factor 2A

Features of the cloned cDNA sequence

Description

Length: 3069 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	989 bp
Genome contig ID	gi51511731f_97823679
PolyA signal sequence (None)	+--------+--------+----*----+---- TTTAACTCTTTAGTTTTATTTTAAGAGGGGAAAAC
Flanking genome sequence (247811 - 247860)	----+--------+--------+--------+--------+----* AAAAATATCTTGCAAGCAGAACCTTGGAAAAAAAAAGCCATGAACACTTA

Features of the protein sequence

Description

Length: 499 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92222	4.4e-137	100.0	MADS box transc...	Homo sapiens
BAG10665	1.3e-136	100.0	myocyte-specifi...	synthetic construct
EAX02252	1.8e-135	98.4	MADS box transc...	Homo sapiens
CAA76175	2.1e-135	99.5	serum response ...	Homo sapiens
BAF84524	2.9e-135	99.3	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002100	5	25	PR00404	Transcription factor
	IPR002100	25	40	PR00404	Transcription factor
	IPR002100	40	61	PR00404	Transcription factor
HMMPfam	IPR002100	11	61	PF00319	Transcription factor
HMMSmart	IPR002100	3	62	SM00432	Transcription factor
ProfileScan	IPR002100	3	63	PS50066	Transcription factor
ScanRegExp	IPR002100	5	59	PS00350	Transcription factor

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp