ORK01301

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01301

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01301
Clone name	ha06684
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pSPORT1 vector (GenBank Accession No. U12390). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3' end of the cDNA was inserted at the NotI site of the vector.
Symbol	GNAI1
cDNA sequence	DNA sequence (3293 bp) Predicted protein sequence (458 aa)
HaloTag ORF Clone	FHC01301
Flexi ORF Clone	FXC01301
Description	Guanine nucleotide-binding protein G(i), alpha-1 subunit (Adenylate cyclase-inhibiting G alpha protein).

Features of the cloned cDNA sequence

Description

Length: 3293 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1916 bp
Genome contig ID	gi89161213f_79502101
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- TAAATCCTAATAAATTTAAATTTTTAAAATTTTAC
Flanking genome sequence (184558 - 184607)	----+--------+--------+--------+--------+----* AAACCTATTGGCTAAGTACATTTTGGATTAGAATTTAAGTATCAGTCTGT

Features of the protein sequence

Description

Length: 458 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P63096	2.8e-142	100.0	Guanine nucleot...	Homo sapiens
P10824	5.1e-142	99.7	Guanine nucleot...	Rattus norvegicus
CAB43212	6e-142	99.7	hypothetical pr...	Homo sapiens
Q5RAD4	6.9e-142	99.7	Guanine nucleot...	Pongo abelii
EDL03228	9.4e-142	99.7	guanine nucleot...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR011025	173	285	PD000281	G protein alpha subunit
FPrintScan	IPR001019	139	154	PR00318	Guanine nucleotide binding protein (G-protein)
	IPR001408	183	192	PR00441	G-protein alpha subunit
	IPR001019	271	293	PR00318	Guanine nucleotide binding protein (G-protein)
	IPR001408	289	299	PR00441	G-protein alpha subunit
	IPR001019	300	317	PR00318	Guanine nucleotide binding protein (G-protein)
	IPR001019	322	350	PR00318	Guanine nucleotide binding protein (G-protein)
	IPR001019	368	377	PR00318	Guanine nucleotide binding protein (G-protein)
	IPR001408	382	394	PR00441	G-protein alpha subunit
	IPR001408	400	411	PR00441	G-protein alpha subunit
	IPR001408	447	458	PR00441	G-protein alpha subunit
HMMPfam	IPR001019	110	457	PF00503	Guanine nucleotide binding protein (G-protein)
HMMSmart	NULL	117	457	SM00275	NULL

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp