ORK01309

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01309

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01309
Clone name	hk00579
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	MAPK14
cDNA sequence	DNA sequence (4158 bp) Predicted protein sequence (486 aa)
HaloTag ORF Clone	FHC01309
Flexi ORF Clone	FXC01309
Description	Mitogen-activated protein kinase 14 (EC 2.7.11.24) (Mitogen-activated protein kinase p38 alpha) (MAP kinase p38 alpha) (Cytokine suppressive anti-inflammatory drug-binding protein) (CSAID-binding protein) (CSBP) (MAX-interacting protein 2) (MAP kinase MXI

Features of the cloned cDNA sequence

Description

Length: 4158 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2696 bp
Genome contig ID	gi89161210f_36003534
PolyA signal sequence (None)	+--------+--------+----*----+---- AGAATGGCTTTTACATTTTTAAATGGTTGGGAAAG
Flanking genome sequence (183366 - 183415)	----+--------+--------+--------+--------+----* AAAAAAAAAGAAGTAGTAGATTTTGTAGCATGTGATGTAAGTAATGTAAA

Features of the protein sequence

Description

Length: 486 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL22584	3.1e-130	89.6	mitogen activat...	Mus musculus
Q95NE7	1.3e-129	100.0	Mitogen-activat...	Pan troglodytes
XP_001929526	5e-129	99.4	mitogen-activat...	Sus scrofa
BAC40726	7.4e-129	99.4	unnamed protein...	Mus musculus
AAH92193	8.5e-129	99.1	Mitogen activat...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	152	388	PD000001	Protein kinase
FPrintScan	IPR008352	138	147	PR01773	p38 MAP kinase
	IPR008352	319	329	PR01773	p38 MAP kinase
	IPR008352	396	409	PR01773	p38 MAP kinase
	IPR008352	412	420	PR01773	p38 MAP kinase
	IPR008352	433	443	PR01773	p38 MAP kinase
HMMPfam	IPR000719	150	434	PF00069	Protein kinase
HMMSmart	IPR001245	150	434	SM00219	Tyrosine protein kinase
HMMSmart	IPR002290	150	434	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	150	434	PS50011	Protein kinase
ScanRegExp	IPR000719	156	180	PS00107	Protein kinase
ScanRegExp	IPR003527	185	288	PS01351	MAP kinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp