ORK01332

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01332

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01332
Clone name	hh15590
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ADAM12
cDNA sequence	DNA sequence (5709 bp) Predicted protein sequence (864 aa)
HaloTag ORF Clone	FHC01332
Flexi ORF Clone	FXC01332
Description	ADAM 12 precursor (EC 3.4.24.-) (A disintegrin and metalloproteinase domain 12) (Meltrin alpha).

Features of the cloned cDNA sequence

Description

Length: 5709 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2939 bp
Genome contig ID	gi89161187r_127592897
PolyA signal sequence (AATACA,-19)	+--------+--------+----*----+---- TGTTCCCAGGCAAATCAATACATCAATGCATCCTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAAAACCGGCTAAAACTGTGTCAAAATGTTC

Features of the protein sequence

Description

Length: 864 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10712	100.0	ADAM metallopep...	synthetic construct
EAW49208	94.9	ADAM metallopep...	Homo sapiens
O43184	94.6	Disintegrin and...	Homo sapiens
CAI40682	94.4	ADAM metallopep...	Homo sapiens
XP_508106	93.5	ADAM metallopep...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001762	419	460	PD000664	Blood coagulation inhibitor
FPrintScan	IPR001762	419	438	PR00289	Blood coagulation inhibitor
FPrintScan	IPR001762	448	460	PR00289	Blood coagulation inhibitor
HMMPfam	IPR002870	21	168	PF01562	Peptidase M12B
	IPR001590	206	371	PF01421	Peptidase M12B
	IPR001762	388	463	PF00200	Blood coagulation inhibitor
	IPR006586	465	587	PF08516	ADAM
	IPR013111	615	642	PF07974	EGF
HMMSmart	IPR001762	388	463	SM00050	Blood coagulation inhibitor
HMMSmart	IPR006586	464	607	SM00608	ADAM
ProfileScan	IPR001590	206	371	PS50215	Peptidase M12B
	IPR001762	379	465	PS50214	Blood coagulation inhibitor
	IPR000742	611	643	PS50026	EGF-like
ScanRegExp	IPR006025	302	311	PS00142	Peptidase M
ScanRegExp	IPR001762	419	438	PS00427	Blood coagulation inhibitor

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	7	ARPLPVSPARALLLALAGALLAP	29	SECONDARY	23
SOSUI2	2	662	QGLTIGILVTILCLLAAGFVVYL	684	PRIMARY	23