ORK01346

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01346

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01346
Clone name	fj00853
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	NTRK3
cDNA sequence	DNA sequence (4391 bp) Predicted protein sequence (617 aa)
HaloTag ORF Clone	FHC01346
Flexi ORF Clone	FXC01346
Description	neurotrophic tyrosine kinase, receptor, type 3

Features of the cloned cDNA sequence

Description

Length: 4391 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1978 bp
Genome contig ID	gi51511731r_86221602
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- GTATAGTTTCTTAATAAACACTTTATTTTCTAATG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATGACTGAATCAGACCTCTTATTTGGAAATTTTGCAAAAACATTCAAA

Features of the protein sequence

Description

Length: 617 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH13693	100.0	Neurotrophic ty...	Homo sapiens
AAB33112	99.8	trkC [Homo sapi...	Homo sapiens
XP_001087841	99.1	neurotrophic ty...	Macaca mulatta
AAB26717	95.9	receptor tyrosi...	Rattus sp.
AAB26723	95.9	receptor tyrosi...	Rattus sp.

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000372	36	63	PF01462	Leucine-rich repeat
	IPR001611	133	155	PF00560	Leucine-rich repeat
	IPR013151	229	291	PF00047	Immunoglobulin
	IPR013098	330	357	PF07679	Immunoglobulin I-set
HMMSmart	IPR000372	36	68	SM00013	Leucine-rich repeat
	IPR000483	165	213	SM00082	Cysteine-rich flanking region
	IPR003599	221	307	SM00409	Immunoglobulin subtype
ProfileScan	IPR007110	215	305	PS50835	Immunoglobulin-like

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	19	RIFLLGSVWLDYVGSVLACPANC	41	SECONDARY	23
SOSUI2	2	436	GVSIAVGLAAFACVLLVVLFVMI	458	PRIMARY	23