ORK01347

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01347

Order Kazusa clone(s) from :

Accession No	AB209184
Product ID	ORK01347
Clone name	fj01782
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	IGF1
cDNA sequence	DNA sequence (4383 bp) Predicted protein sequence (184 aa)
HaloTag ORF Clone	FHC01347
Flexi ORF Clone	FXC01347
Description	Insulin-like growth factor IA precursor (IGF-IA) (Somatomedin C) (Mechano growth factor) (MGF).

Features of the cloned cDNA sequence

Description

Length: 4383 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3706 bp
Genome contig ID	gi89161190r_101216718
PolyA signal sequence (AAGAAA,-27)	+--------+--------+----*----+---- GTTTCTTTAAGAAAGTACTTGACTAAAAAAAAAAG
Flanking genome sequence (99989 - 99940)	----+--------+--------+--------+--------+----* AAAAAAAGAAAAAAAAGAAAGCATAGACATATTTTTTTAAAGTATAAAAA

Features of the protein sequence

Description

Length: 184 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92421	3.9e-86	100.0	insulin-like gr...	Homo sapiens
1001199A	1.7e-70	100.0	insulin-like gr...	Homo sapiens
P01343	2.5e-69	100.0	Insulin-like gr...	Homo sapiens
Q6JLX1	1.6e-68	98.6	Insulin-like gr...	Ailuropoda mela...
Q6IVA5	5.2e-68	98.0	Insulin-like gr...	Ailurus fulgens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR004824	58	83	PD001048	Bombyxin
BlastProDom	IPR003234	84	140	PD015667	Insulin-related peptide
FPrintScan	IPR004825	81	94	PR00277	Insulin/IGF/relaxin
FPrintScan	IPR004825	95	107	PR00277	Insulin/IGF/relaxin
HMMPfam	IPR004825	82	140	PF00049	Insulin/IGF/relaxin
HMMSmart	IPR004825	82	140	SM00078	Insulin/IGF/relaxin
ScanRegExp	IPR004825	126	140	PS00262	Insulin/IGF/relaxin

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp