ORK01348

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01348

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01348
Clone name	hj05054
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	SYT1
cDNA sequence	DNA sequence (4813 bp) Predicted protein sequence (429 aa)
HaloTag ORF Clone	FHC01348
Flexi ORF Clone	FXC01348
Description	synaptotagmin I

Features of the cloned cDNA sequence

Description

Length: 4813 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2880 bp
Genome contig ID	gi89161190f_77682743
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- CACAGATATTCAATAAAAATGTTTTATTTCCTGTT
Flanking genome sequence (687176 - 687225)	----+--------+--------+--------+--------+----* GATGTTGCTGCGTTCCCACTCTTTTCCTTGCCTGACTCTGGTGGTAAGCC

Features of the protein sequence

Description

Length: 429 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P21579	6e-171	100.0	Synaptotagmin-1...	Homo sapiens
P48018	1.5e-170	99.7	Synaptotagmin-1...	Bos taurus
CAH93492	4.2e-170	99.5	hypothetical pr...	Pongo abelii
CAH91359	4.2e-170	99.2	hypothetical pr...	Pongo abelii
CAH91262	4.8e-170	99.5	hypothetical pr...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000008	181	193	PR00360	C2 calcium-dependent membrane targeting
	IPR000008	208	221	PR00360	C2 calcium-dependent membrane targeting
	IPR000008	232	240	PR00360	C2 calcium-dependent membrane targeting
	IPR001565	284	299	PR00399	Synaptotagmin
	IPR001565	299	312	PR00399	Synaptotagmin
	IPR001565	356	371	PR00399	Synaptotagmin
	IPR001565	376	386	PR00399	Synaptotagmin
HMMPfam	IPR000008	166	252	PF00168	C2 calcium-dependent membrane targeting
HMMPfam	IPR000008	297	385	PF00168	C2 calcium-dependent membrane targeting
HMMSmart	IPR000008	165	267	SM00239	C2 calcium-dependent membrane targeting
HMMSmart	IPR000008	296	410	SM00239	C2 calcium-dependent membrane targeting
ProfileScan	IPR000008	164	252	PS50004	C2 calcium-dependent membrane targeting
ProfileScan	IPR000008	294	385	PS50004	C2 calcium-dependent membrane targeting

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	66	WALIAIAIVAVLLVLTCCFCIC	87	PRIMARY	22