ORK01351

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01351

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01351
Clone name	fj13272
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	KLF10
cDNA sequence	DNA sequence (4382 bp) Predicted protein sequence (474 aa)
HaloTag ORF Clone	FHC01351
Flexi ORF Clone	FXC01351
Description	Krueppel-like factor 10 (Transforming growth factor-beta-inducible early growth response protein 1) (TGFB-inducible early growth response protein 1) (TIEG-1) (EGR-alpha).

Features of the cloned cDNA sequence

Description

Length: 4382 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1347 bp
Genome contig ID	gi51511724r_103630189
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TTATATCTTGTTTACAATAAAGAATTCCCTTTGGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATATGGAATGGTCATTGCATTTCTTAAAAACCATTCTCAACTCTCACCTT

Features of the protein sequence

Description

Length: 474 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAB36088	2.1e-152	100.0	zinc finger tra...	Homo sapiens
Q13118	4.8e-152	100.0	Krueppel-like f...	Homo sapiens
AAX42667	4.8e-152	100.0	TGFB inducible ...	synthetic construct
XP_001154222	5.3e-152	99.5	Kruppel-like fa...	Pan troglodytes
XP_528205	1.2e-151	99.5	Kruppel-like fa...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	363	388	PD000003	Zinc finger
	IPR007087	393	418	PD000003	Zinc finger
	IPR007087	423	445	PD000003	Zinc finger
HMMPfam	IPR007087	363	387	PF00096	Zinc finger
	IPR007087	393	417	PF00096	Zinc finger
	IPR007087	423	445	PF00096	Zinc finger
HMMSmart	IPR015880	363	387	SM00355	Zinc finger
	IPR015880	393	417	SM00355	Zinc finger
	IPR015880	423	445	SM00355	Zinc finger
ProfileScan	IPR007087	363	392	PS50157	Zinc finger
	IPR007087	393	422	PS50157	Zinc finger
	IPR007087	423	450	PS50157	Zinc finger
ScanRegExp	IPR007087	365	387	PS00028	Zinc finger
	IPR007087	395	417	PS00028	Zinc finger
	IPR007087	425	445	PS00028	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp