ORK01352

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01352

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01352
Clone name	fj13691
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	MAP4K3
cDNA sequence	DNA sequence (4194 bp) Predicted protein sequence (951 aa)
HaloTag ORF Clone	FHC01352
Flexi ORF Clone	FXC01352
Description	Mitogen-activated protein kinase kinase kinase kinase 3 (EC 2.7.11.1) (MAPK/ERK kinase kinase kinase 3) (MEK kinase kinase 3) (MEKKK 3) (Germinal center kinase-related protein kinase) (GLK).

Features of the cloned cDNA sequence

Description

Length: 4194 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1336 bp
Genome contig ID	gi89161199r_39229927
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- ATTGTACATATTGTAAAATAAACATGTTTTTTAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGCTGTTGTATAGTAGCTTGTCATCTGGTTTAATCTGTATATAGTAACA

Features of the protein sequence

Description

Length: 951 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_515427	94.5	mitogen-activat...	Pan troglodytes
Q8IVH8	100.0	Mitogen-activat...	Homo sapiens
BAF84156	99.8	unnamed protein...	Homo sapiens
AAC15472	99.8	germinal center...	Homo sapiens
XP_001103468	94.7	similar to mito...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	73	329	PD000001	Protein kinase
HMMPfam	IPR000719	73	330	PF00069	Protein kinase
HMMPfam	IPR001180	619	931	PF00780	Citron-like
HMMSmart	IPR001245	73	330	SM00219	Tyrosine protein kinase
	IPR002290	73	330	SM00220	Serine/threonine protein kinase
	IPR001180	618	931	SM00036	Citron-like
ProfileScan	IPR000719	73	330	PS50011	Protein kinase
ScanRegExp	IPR000719	79	102	PS00107	Protein kinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp