ORK01365

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01365

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01365
Clone name	fk02388
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	DDX42
cDNA sequence	DNA sequence (3923 bp) Predicted protein sequence (1000 aa)
HaloTag ORF Clone	FHC01365
Flexi ORF Clone	FXC01365
Description	DEAD (Asp-Glu-Ala-Asp) box polypeptide 42

Features of the cloned cDNA sequence

Description

Length: 3923 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	918 bp
Genome contig ID	gi51511734f_59105352
PolyA signal sequence (AGTAAA,-21)	+--------+--------+----*----+---- TCTGCTTGCTCTCTAGTAAATGTTTTACTACCGGG
Flanking genome sequence (145058 - 145107)	----+--------+--------+--------+--------+----* ACCTGTGGATCGTTTGTCATTTCTGTCTATGAATTGGTACATATTAAGAA

Features of the protein sequence

Description

Length: 1000 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q86XP3	100.0	ATP-dependent R...	Homo sapiens
XP_001147663	99.7	DEAD box polype...	Pan troglodytes
EAW94278	99.6	DEAD (Asp-Glu-A...	Homo sapiens
XP_001116381	99.2	similar to DEAD...	Macaca mulatta
NP_001126368	98.8	ATP-dependent R...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011545	339	510	PF00270	DNA/RNA helicase
HMMPfam	IPR001650	579	655	PF00271	DNA/RNA helicase
HMMSmart	IPR014001	334	536	SM00487	DEAD-like helicases
HMMSmart	IPR001650	574	655	SM00490	DNA/RNA helicase
ProfileScan	IPR014014	315	343	PS51195	RNA helicase
	IPR014021	346	521	PS51192	Helicase
	IPR001650	549	694	PS51194	DNA/RNA helicase
ScanRegExp	IPR000629	467	475	PS00039	RNA helicase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp