Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01371
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209290
Product ID ORK01371
Clone name fk06592
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol KIFC3
cDNA sequence DNA sequence (3328 bp)
Predicted protein sequence (870 aa)
Flexi ORF Clone FXC01371
Description Kinesin-like protein KIFC3.
Features of the cloned cDNA sequence

Length: 3328 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 715 bp
Genome contig ID gi51511732r_56249632
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
TTTTACTTATTAAAATAAAAGAAGCCTTTTTACAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGTATGGTCTGAAAAAGTTGGTCTGTGAGCCCCTCTTGGTCTGATTAGG

Features of the protein sequence

Length: 870 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92527 0 100.0 Kinesin-like pr...
Homo sapiens
EAW82954 0 100.0 kinesin family ...
Homo sapiens
BAG10766 0 100.0 kinesin family ...
synthetic construct
Q9BVG8 0 100.0 Kinesin-like pr...
Homo sapiens
AAH01211 0 100.0 Kinesin family ...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR001752 563 584 PR00380 Kinesin
IPR001752 682 699 PR00380 Kinesin
IPR001752 713 731 PR00380 Kinesin
IPR001752 762 783 PR00380 Kinesin
HMMPfam IPR001752 495 813 PF00225 Kinesin
HMMSmart IPR001752 487 820 SM00129 Kinesin
ProfileScan IPR001752 486 743 PS50067 Kinesin
ScanRegExp IPR001752 712 723 PS00411 Kinesin
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp