ORK01385

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01385

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01385
Clone name	fh18433
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	EPHA5
cDNA sequence	DNA sequence (5176 bp) Predicted protein sequence (1017 aa)
HaloTag ORF Clone	FHC01385
Flexi ORF Clone	FXC01385
Description	EPH receptor A5

Features of the cloned cDNA sequence

Description

Length: 5176 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1408 bp
Genome contig ID	gi89161207r_65778874
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- ATTACTTGTAAATATATAATAAAATTATTTGCATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACAATGTCTCTTTTGTTATTAAAATAGCACATTTTCTGTATATAGTTA

Features of the protein sequence

Description

Length: 1017 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92612	100.0	ephrin receptor...	Homo sapiens
BAG10783	100.0	ephrin type-A r...	synthetic construct
EAX05537	100.0	EPH receptor A5...	Homo sapiens
XP_001165075	99.7	ephrin receptor...	Pan troglodytes
XP_001109851	99.4	similar to ephr...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001090	81	247	PD001495	Ephrin receptor
BlastProDom	IPR000719	696	953	PD000001	Protein kinase
FPrintScan	IPR003962	496	505	PR00014	Fibronectin
	IPR003962	509	519	PR00014	Fibronectin
	IPR003962	531	549	PR00014	Fibronectin
	IPR003962	549	563	PR00014	Fibronectin
	IPR001245	767	780	PR00109	Tyrosine protein kinase
	IPR001245	804	822	PR00109	Tyrosine protein kinase
	IPR001245	854	864	PR00109	Tyrosine protein kinase
	IPR001245	873	895	PR00109	Tyrosine protein kinase
	IPR001245	917	939	PR00109	Tyrosine protein kinase
HMMPfam	IPR001090	73	246	PF01404	Ephrin receptor
	IPR015215	303	319	PF09132	BmKX
	IPR003961	371	464	PF00041	Fibronectin
	IPR003961	482	565	PF00041	Fibronectin
	IPR001245	689	946	PF07714	Tyrosine protein kinase
	IPR001660	977	1017	PF00536	Sterile alpha motif SAM
HMMSmart	IPR001090	73	246	SM00615	Ephrin receptor
	IPR003961	371	461	SM00060	Fibronectin
	IPR003961	482	562	SM00060	Fibronectin
	IPR002290	689	950	SM00220	Serine/threonine protein kinase
	IPR001245	689	946	SM00219	Tyrosine protein kinase
ProfileScan	IPR003961	370	472	PS50853	Fibronectin
	IPR003961	482	572	PS50853	Fibronectin
	IPR000719	689	950	PS50011	Protein kinase
	IPR001660	979	1017	PS50105	Sterile alpha motif SAM
ScanRegExp	IPR001426	227	247	PS00790	Receptor tyrosine kinase
	IPR001426	289	309	PS00791	Receptor tyrosine kinase
	IPR013032	302	315	PS01186	EGF-like region
	IPR000719	695	721	PS00107	Protein kinase
	IPR008266	810	822	PS00109	Tyrosine protein kinase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	51	APLWTCLLLCAALRTLLASPSNE	73	PRIMARY	23
SOSUI2	2	588	VIAVSVTVGVILLAVVIGVLLSG	610	PRIMARY	23