ORK01397

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01397

Order Kazusa clone(s) from :

Accession No	AB209411
Product ID	ORK01397
Clone name	fh25839
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PML
cDNA sequence	DNA sequence (5393 bp) Predicted protein sequence (862 aa)
HaloTag ORF Clone	FHC01397
Flexi ORF Clone	FXC01397
Description	Probable transcription factor PML (Tripartite motif-containing protein 19) (RING finger protein 71).

Features of the cloned cDNA sequence

Description

Length: 5393 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2804 bp
Genome contig ID	gi51511731f_71974123
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- GAATTATAGGAAAATAAACACATTTTAGATCTTAG
Flanking genome sequence (153085 - 153134)	----+--------+--------+--------+--------+----* AAAAAAACAAAAAAACATGGGCTTGTCTTCAGGGTAGTAAAGAACAAGAT

Features of the protein sequence

Description

Length: 862 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92648	0	100.0	promyelocytic l...	Homo sapiens
BAG10798	0	100.0	promyelocytic l...	synthetic construct
AAG50190	3.5e-182	99.8	tripartite moti...	Homo sapiens
NP_032910	2.2e-175	70.1	probable transc...	Mus musculus
AAH20990	4.4e-175	70.1	Pml protein [Mu...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001841	85	119	PF00097	Zinc finger
	IPR000315	152	194	PF00643	Zinc finger
	IPR000315	212	260	PF00643	Zinc finger
HMMSmart	IPR001841	85	119	SM00184	Zinc finger
HMMSmart	IPR000315	152	194	SM00336	Zinc finger
ProfileScan	IPR001841	85	120	PS50089	Zinc finger
	IPR000315	152	194	PS50119	Zinc finger
	IPR000315	212	250	PS50119	Zinc finger
ScanRegExp	IPR001841	100	109	PS00518	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp