ORK01403

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01403

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01403
Clone name	bm05658
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	CALM3
cDNA sequence	DNA sequence (2114 bp) Predicted protein sequence (161 aa)
HaloTag ORF Clone	FHC01403
Flexi ORF Clone	FXC01403
Description	calmodulin 3 (phosphorylase kinase, delta)

Features of the cloned cDNA sequence

Description

Length: 2114 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1628 bp
Genome contig ID	gi42406306f_51696496
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- ATCAATGTTTTCCAATAAAATACAGTGACTACCTG
Flanking genome sequence (109384 - 109433)	----+--------+--------+--------+--------+----* ATTTGGCTCCTCTCCTCCTGTCTCAGTTTCTGGCCTGCCCCCCTCCAACA

Features of the protein sequence

Description

Length: 161 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_512771	4.8e-58	100.0	similar to calm...	Pan troglodytes
XP_001112409	5.6e-58	99.3	similar to calm...	Macaca mulatta
2WEL	7.2e-53	99.3	CALCIUM/CALMODU...	Homo sapiens
P62161	8.3e-53	100.0	Calmodulin; Sho...	Rattus norvegicus
AAX37095	8.4e-53	100.0	calmodulin 2 [s...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR002048	18	57	PD000012	Calcium-binding EF-hand
BlastProDom	IPR002048	64	149	PD000012	Calcium-binding EF-hand
FPrintScan	IPR001125	17	36	PR00450	Recoverin
	IPR001125	64	85	PR00450	Recoverin
	IPR001125	111	129	PR00450	Recoverin
HMMPfam	IPR002048	24	52	PF00036	Calcium-binding EF-hand
	IPR002048	60	88	PF00036	Calcium-binding EF-hand
	IPR002048	97	125	PF00036	Calcium-binding EF-hand
	IPR002048	133	161	PF00036	Calcium-binding EF-hand
HMMSmart	IPR002048	24	52	SM00054	Calcium-binding EF-hand
	IPR002048	60	88	SM00054	Calcium-binding EF-hand
	IPR002048	97	125	SM00054	Calcium-binding EF-hand
	IPR002048	133	161	SM00054	Calcium-binding EF-hand
ProfileScan	IPR002048	20	55	PS50222	Calcium-binding EF-hand
	IPR002048	56	91	PS50222	Calcium-binding EF-hand
	IPR002048	93	128	PS50222	Calcium-binding EF-hand
	IPR002048	129	161	PS50222	Calcium-binding EF-hand
ScanRegExp	IPR002048	33	45	PS00018	Calcium-binding EF-hand
	IPR002048	69	81	PS00018	Calcium-binding EF-hand
	IPR002048	106	118	PS00018	Calcium-binding EF-hand
	IPR002048	142	154	PS00018	Calcium-binding EF-hand

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp