ORK01406

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01406

Order Kazusa clone(s) from :

Accession No	AB209456
Product ID	ORK01406
Clone name	ah02979
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ABL1
cDNA sequence	DNA sequence (5583 bp) Predicted protein sequence (1167 aa)
HaloTag ORF Clone	FHC01406
Flexi ORF Clone	FXC01406
Description	Proto-oncogene tyrosine-protein kinase ABL1 (EC 2.7.10.2) (p150) (c- ABL) (Abelson murine leukemia viral oncogene homolog 1).

Features of the cloned cDNA sequence

Description

Length: 5583 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	1988 bp
Genome contig ID	gi89161216f_132479383
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- CTGTAGTATTTTTTAAATAAATCAGTGTTTACATT
Flanking genome sequence (273498 - 273547)	----+--------+--------+--------+--------+----* AGAATTCTTGGCAGATTGCTTCGGCCTGTGATCCTGCCCTGTTGTTCTGA

Features of the protein sequence

Description

Length: 1167 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92693	100.0	v-abl Abelson m...	Homo sapiens
AAB60393	100.0	proto-oncogene ...	Homo sapiens
XP_001166213	99.9	v-abl Abelson m...	Pan troglodytes
EAW87947	99.9	v-abl Abelson m...	Homo sapiens
P00519	98.4	Tyrosine-protei...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	102	154	PD000066	Src homology-3
	IPR000980	164	256	PD000093	SH2 motif
	IPR000719	282	523	PD000001	Protein kinase
FPrintScan	IPR001452	101	111	PR00452	Src homology-3
	IPR001452	115	130	PR00452	Src homology-3
	IPR001452	144	156	PR00452	Src homology-3
	IPR000980	164	178	PR00401	SH2 motif
	IPR000980	183	193	PR00401	SH2 motif
	IPR000980	195	206	PR00401	SH2 motif
	IPR000980	207	217	PR00401	SH2 motif
	IPR000980	228	242	PR00401	SH2 motif
	IPR001245	352	365	PR00109	Tyrosine protein kinase
	IPR001245	390	408	PR00109	Tyrosine protein kinase
	IPR001245	438	448	PR00109	Tyrosine protein kinase
	IPR001245	457	479	PR00109	Tyrosine protein kinase
	IPR001245	501	523	PR00109	Tyrosine protein kinase
HMMPfam	IPR001452	101	156	PF00018	Src homology-3
	IPR000980	164	239	PF00017	SH2 motif
	IPR001245	279	530	PF07714	Tyrosine protein kinase
	IPR015015	990	1167	PF08919	F-actin binding
HMMSmart	IPR001452	101	157	SM00326	Src homology-3
	IPR000980	162	245	SM00252	SH2 motif
	IPR001245	279	530	SM00219	Tyrosine protein kinase
	IPR002290	279	534	SM00220	Serine/threonine protein kinase
	IPR015015	1041	1167	SM00808	F-actin binding
ProfileScan	IPR001452	98	158	PS50002	Src homology-3
	IPR000980	164	254	PS50001	SH2 motif
	IPR000719	279	530	PS50011	Protein kinase
ScanRegExp	IPR000719	285	308	PS00107	Protein kinase
ScanRegExp	IPR008266	396	408	PS00109	Tyrosine protein kinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp