Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01413
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01413
Clone name fk09019
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol SUV420H1
cDNA sequence DNA sequence (3460 bp)
Predicted protein sequence (906 aa)
Flexi ORF Clone FXC01413
Description Histone-lysine N-methyltransferase SUV420H1 (EC 2.1.1.43) (Suppressor of variegation 4-20 homolog 1) (Suv4-20h1) (Su(var)4-20 homolog 1).
Features of the cloned cDNA sequence

Length: 3460 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 579 bp
Genome contig ID gi51511727r_67581152
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CGCAAACCATTGGTTGGGAGTCAGATTGGTTTCTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAATGACATACGTGACAGCTCACTTTTCAGTTCATTA

Features of the protein sequence

Length: 906 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q4FZB7 0 100.0 Histone-lysine ...
Homo sapiens
XP_001173516 0 99.6 suppressor of v...
Pan troglodytes
XP_001103268 0 99.2 similar to supp...
Macaca mulatta
XP_001173499 0 99.6 suppressor of v...
Pan troglodytes
XP_851524 0 90.7 similar to supp...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001214 194 335 PF00856 SET
HMMSmart IPR001214 219 335 SM00317 SET
ProfileScan IPR001214 289 333 PS50280 SET
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp