Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01421
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01421
Clone name fk12595
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol PLA2G6
cDNA sequence DNA sequence (3157 bp)
Predicted protein sequence (823 aa)
Flexi ORF Clone FXC01421
Description 85 kDa calcium-independent phospholipase A2 (EC 3.1.1.4) (iPLA2) (CaI- PLA2) (Group VI phospholipase A2) (GVI PLA2).
Features of the cloned cDNA sequence

Length: 3157 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 664 bp
Genome contig ID gi89161203r_36737450
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
AGCCAAAACTGAAATAAATCATTTGGATTCAAGTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CACCTGTGTTGTGTGTGCAGTGGTGTGAGATCCACCTGTTCCCCTGACCC

Features of the protein sequence

Length: 823 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
T12503 0 99.8 B096R Heart Hom...
Homo sapiens
O60733 0 100.0 85 kDa calcium-...
Homo sapiens
AAD41723 0 99.8 Ca2+-independen...
Homo sapiens
AAC97486 0 99.8 calcium-indepen...
Homo sapiens
AAD30424 0 99.6 calcium-indepen...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR002110 237 249 PR01415 Ankyrin
IPR002110 313 325 PR01415 Ankyrin
HMMPfam IPR002110 168 201 PF00023 Ankyrin
IPR002110 202 235 PF00023 Ankyrin
IPR002110 236 268 PF00023 Ankyrin
IPR002110 303 332 PF00023 Ankyrin
IPR002110 333 365 PF00023 Ankyrin
IPR002110 366 398 PF00023 Ankyrin
IPR002641 498 682 PF01734 Patatin
HMMSmart IPR002110 168 198 SM00248 Ankyrin
IPR002110 202 232 SM00248 Ankyrin
IPR002110 236 265 SM00248 Ankyrin
IPR002110 303 329 SM00248 Ankyrin
IPR002110 333 362 SM00248 Ankyrin
IPR002110 366 395 SM00248 Ankyrin
ProfileScan IPR002110 168 201 PS50088 Ankyrin
IPR002110 168 429 PS50297 Ankyrin
IPR002110 236 268 PS50088 Ankyrin
IPR002110 333 365 PS50088 Ankyrin
IPR002110 366 398 PS50088 Ankyrin
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp