Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01422
Order Kazusa clone(s) from : Japan || Other countries
Accession No AK226072
Product ID ORK01422
Clone name fk13183
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol MEIS2
cDNA sequence DNA sequence (3354 bp)
Predicted protein sequence (414 aa)
Flexi ORF Clone FXC01422
Description Homeobox protein Meis2 (Meis1-related protein 1).
Features of the cloned cDNA sequence

Length: 3354 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 1471 bp
Genome contig ID gi51511731r_34870519
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
AAAAAGCGGTAATAAATATTTCATTTTTGATTTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TGTTAGGCTTTTGCGTTTTTAATGGTTTTAGGACAAGACTGCACAATGCC

Features of the protein sequence

Length: 414 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAF81638 1.7e-157 100.0 TALE homeobox p...
Homo sapiens
XP_857274 2.9e-157 99.7 similar to home...
Canis lupus fam...
CAH89453 5.8e-157 99.7 hypothetical pr...
Pongo abelii
AAC52948 7.5e-157 99.5 Meis2 [Mus musc...
Mus musculus
AAF20818 1.3e-156 99.5 homeoprotein Me...
Gallus gallus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR001356 312 346 PD000010 Homeobox
HMMPfam IPR001356 290 349 PF00046 Homeobox
HMMSmart IPR001356 289 354 SM00389 Homeobox
ProfileScan IPR001356 287 350 PS50071 Homeobox
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp