ORK01426

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01426

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01426
Clone name	fk13967
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	HNRNPK
cDNA sequence	DNA sequence (2706 bp) Predicted protein sequence (442 aa)
HaloTag ORF Clone	FHC01426
Flexi ORF Clone	FXC01426
Description	heterogeneous nuclear ribonucleoprotein K

Features of the cloned cDNA sequence

Description

Length: 2706 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1228 bp
Genome contig ID	gi89161216r_85672914
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- ATTCACTTCCAAATAAATAAAACACCCATGATGCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGATTTGATGTGTGCCCGATTTGAACAAGGGTTGATTGACACCTGTAAAA

Features of the protein sequence

Description

Length: 442 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92799	6e-150	100.0	heterogeneous n...	Homo sapiens
BAG10834	2.9e-149	100.0	heterogeneous n...	synthetic construct
XP_857250	8.1e-148	99.0	similar to hete...	Canis lupus fam...
BAC34601	3e-147	99.7	unnamed protein...	Mus musculus
BAE31602	2.4e-146	98.1	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR012987	3	45	PF08067	ROK
	IPR004088	46	106	PF00013	K Homology
	IPR004088	124	187	PF00013	K Homology
	IPR004088	367	429	PF00013	K Homology
HMMSmart	IPR004087	43	111	SM00322	K Homology
	IPR004087	121	192	SM00322	K Homology
	IPR004087	364	434	SM00322	K Homology
ProfileScan	IPR004088	44	106	PS50084	K Homology
	IPR004088	122	187	PS50084	K Homology
	IPR004088	365	429	PS50084	K Homology

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp