ORK01442

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01442

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01442
Clone name	pf07901
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	KLF4
cDNA sequence	DNA sequence (2418 bp) Predicted protein sequence (522 aa)
HaloTag ORF Clone	FHC01442
Flexi ORF Clone	FXC01442
Description	Kruppel-like factor 4 (gut)

Features of the cloned cDNA sequence

Description

Length: 2418 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	831 bp
Genome contig ID	gi89161216r_109187022
PolyA signal sequence (AGTAAA,-19)	+--------+--------+----*----+---- TATTTGTAAACTACAAAGTAAAATGAACATTTTGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GGAGTTTGTATTTTGCATACTCAAGGTGAGAATTAAGTTTTAAATAAACC

Features of the protein sequence

Description

Length: 522 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW59019	7.3e-160	100.0	Kruppel-like fa...	Homo sapiens
BAE02464	1.4e-158	99.3	unnamed protein...	Macaca fascicularis
AAD42165	1.6e-156	100.0	zinc finger tra...	Homo sapiens
AAB48399	1.4e-155	99.1	hEZF [Homo sapi...	Homo sapiens
AAC03462	4.4e-155	99.1	EZF [Homo sapiens].	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	469	494	PD000003	Zinc finger
BlastProDom	IPR007087	499	521	PD000003	Zinc finger
HMMPfam	IPR007087	439	463	PF00096	Zinc finger
	IPR007087	469	493	PF00096	Zinc finger
	IPR007087	499	521	PF00096	Zinc finger
HMMSmart	IPR015880	439	463	SM00355	Zinc finger
	IPR015880	469	493	SM00355	Zinc finger
	IPR015880	499	521	SM00355	Zinc finger
ProfileScan	IPR007087	439	468	PS50157	Zinc finger
	IPR007087	469	498	PS50157	Zinc finger
	IPR007087	499	522	PS50157	Zinc finger
ScanRegExp	IPR007087	441	463	PS00028	Zinc finger
	IPR007087	471	493	PS00028	Zinc finger
	IPR007087	501	521	PS00028	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp