ORK01447

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01447

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01447
Clone name	bm00686
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	CCT2
cDNA sequence	DNA sequence (1808 bp) Predicted protein sequence (551 aa)
HaloTag ORF Clone	FHC01447
Flexi ORF Clone	FXC01447
Description	T-complex protein 1 subunit beta (TCP-1-beta) (CCT-beta).

Features of the cloned cDNA sequence

Description

Length: 1808 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	150 bp
Genome contig ID	gi89161190f_68165519
PolyA signal sequence (None)	+--------+--------+----*----+---- TTGGATATTTAGCTGACCTTCGCTTTAACATAGGT
Flanking genome sequence (116005 - 116054)	----+--------+--------+--------+--------+----* CTAATTTATTTGCCGTGTCATTTTCCATACAAATCAGTTGATTTAAAAAA

Features of the protein sequence

Description

Length: 551 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_509216	4.2e-212	100.0	chaperonin cont...	Pan troglodytes
XP_001108460	7.2e-212	99.8	similar to chap...	Macaca mulatta
P78371	3.1e-205	100.0	T-complex prote...	Homo sapiens
AAV38768	3.1e-205	100.0	chaperonin cont...	synthetic construct
BAF83456	7.5e-205	99.8	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002423	53	69	PR00304	Chaperonin Cpn60/TCP-1
	IPR001844	55	81	PR00298	Chaperonin Cpn60
	IPR002423	77	95	PR00304	Chaperonin Cpn60/TCP-1
	IPR002423	107	126	PR00304	Chaperonin Cpn60/TCP-1
	IPR001844	109	136	PR00298	Chaperonin Cpn60
	IPR002423	388	410	PR00304	Chaperonin Cpn60/TCP-1
	IPR001844	408	429	PR00298	Chaperonin Cpn60
	IPR002423	422	434	PR00304	Chaperonin Cpn60/TCP-1
HMMPfam	IPR002423	51	541	PF00118	Chaperonin Cpn60/TCP-1
HMMTigr	IPR012716	26	544	TIGR02341	T-complex protein 1
ScanRegExp	IPR002194	56	68	PS00750	Chaperonin TCP-1
	IPR002194	79	95	PS00751	Chaperonin TCP-1
	IPR002194	107	115	PS00995	Chaperonin TCP-1
	IPR000719	111	136	PS00107	Protein kinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp