Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01451
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209710
Product ID ORK01451
Clone name bm01576
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol ZNF668
cDNA sequence DNA sequence (2091 bp)
Predicted protein sequence (623 aa)
Flexi ORF Clone FXC01451
Description Zinc finger protein 668.
Features of the cloned cDNA sequence

Length: 2091 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 217 bp
Genome contig ID gi51511732r_30879673
PolyA signal sequence
(ATTAAA,-20)
+----*----+----*----+----*----+----
CTAGGAGTAACACTCATTAAAGCTTTCATTTTGGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACCAGGTCATCTTCTGTGTTCTGGTTGGGAGTGAATGGGTGGGAGTTTGG

Features of the protein sequence

Length: 623 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92947 0 100.0 hypothetical pr...
Homo sapiens
Q96K58 0 100.0 Zinc finger pro...
Homo sapiens
BAG37991 0 99.8 unnamed protein...
Homo sapiens
BAB55084 0 99.8 unnamed protein...
Homo sapiens
AAH21997 0 99.8 Zinc finger pro...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 228 250 PD000003 Zinc finger
IPR007087 256 279 PD000003 Zinc finger
IPR007087 312 335 PD000003 Zinc finger
IPR007087 396 418 PD000003 Zinc finger
IPR007087 548 571 PD000003 Zinc finger
HMMPfam IPR007087 88 110 PF00096 Zinc finger
IPR007087 116 138 PF00096 Zinc finger
IPR007087 144 166 PF00096 Zinc finger
IPR007087 172 194 PF00096 Zinc finger
IPR007087 200 222 PF00096 Zinc finger
IPR007087 228 250 PF00096 Zinc finger
IPR007087 256 278 PF00096 Zinc finger
IPR007087 284 306 PF00096 Zinc finger
IPR007087 312 334 PF00096 Zinc finger
IPR007087 340 362 PF00096 Zinc finger
IPR007087 368 390 PF00096 Zinc finger
IPR007087 396 418 PF00096 Zinc finger
IPR007087 520 542 PF00096 Zinc finger
IPR007087 548 570 PF00096 Zinc finger
IPR007087 576 598 PF00096 Zinc finger
HMMSmart IPR015880 26 48 SM00355 Zinc finger
IPR015880 88 110 SM00355 Zinc finger
IPR015880 116 138 SM00355 Zinc finger
IPR015880 144 166 SM00355 Zinc finger
IPR015880 172 194 SM00355 Zinc finger
IPR015880 200 222 SM00355 Zinc finger
IPR015880 228 250 SM00355 Zinc finger
IPR015880 256 278 SM00355 Zinc finger
IPR015880 284 306 SM00355 Zinc finger
IPR015880 312 334 SM00355 Zinc finger
IPR015880 340 362 SM00355 Zinc finger
IPR015880 368 390 SM00355 Zinc finger
IPR015880 396 418 SM00355 Zinc finger
IPR015880 520 542 SM00355 Zinc finger
IPR015880 548 570 SM00355 Zinc finger
IPR015880 576 598 SM00355 Zinc finger
ProfileScan IPR007087 26 48 PS50157 Zinc finger
IPR007087 88 115 PS50157 Zinc finger
IPR007087 116 143 PS50157 Zinc finger
IPR007087 144 171 PS50157 Zinc finger
IPR007087 172 199 PS50157 Zinc finger
IPR007087 200 227 PS50157 Zinc finger
IPR007087 228 255 PS50157 Zinc finger
IPR007087 256 283 PS50157 Zinc finger
IPR007087 284 311 PS50157 Zinc finger
IPR007087 312 339 PS50157 Zinc finger
IPR007087 340 367 PS50157 Zinc finger
IPR007087 368 395 PS50157 Zinc finger
IPR007087 396 423 PS50157 Zinc finger
IPR007087 520 547 PS50157 Zinc finger
IPR007087 548 575 PS50157 Zinc finger
IPR007087 576 598 PS50157 Zinc finger
ScanRegExp IPR007087 28 48 PS00028 Zinc finger
IPR007087 90 110 PS00028 Zinc finger
IPR007087 118 138 PS00028 Zinc finger
IPR007087 146 166 PS00028 Zinc finger
IPR007087 174 194 PS00028 Zinc finger
IPR007087 202 222 PS00028 Zinc finger
IPR007087 230 250 PS00028 Zinc finger
IPR007087 258 278 PS00028 Zinc finger
IPR007087 286 306 PS00028 Zinc finger
IPR007087 314 334 PS00028 Zinc finger
IPR007087 342 362 PS00028 Zinc finger
IPR007087 370 390 PS00028 Zinc finger
IPR007087 398 418 PS00028 Zinc finger
IPR007087 522 542 PS00028 Zinc finger
IPR007087 550 570 PS00028 Zinc finger
IPR007087 578 598 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp