Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01452
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01452
Clone name bm01873
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol STIP1
cDNA sequence DNA sequence (1810 bp)
Predicted protein sequence (543 aa)
Flexi ORF Clone FXC01452
Description Stress-induced-phosphoprotein 1 (STI1) (Hsc70/Hsp90-organizing protein) (Hop) (Transformation-sensitive protein IEF SSP 3521) (NY- REN-11 antigen).
Features of the cloned cDNA sequence

Length: 1810 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 178 bp
Genome contig ID gi51511727f_63617123
PolyA signal sequence
(None)		 
+----*----+----*----+----*----+----
GACTCGTACCTGCGCTGTTTGTGCCGCCGCTGCCT
Flanking genome sequence
(111231 - 111280)		 
----+----*----+----*----+----*----+----*----+----*
CTGGGCCCTCCCAGCACACGCATGGTCTCTTCACCGCTGCCCTCGAGTTC

Features of the protein sequence

Length: 543 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
P31948 5.1e-184 100.0 Stress-induced-...
 Homo sapiens
BAF84244 2.8e-183 99.8 unnamed protein...
 Homo sapiens
EAW74197 4.9e-183 99.4 stress-induced-...
 Homo sapiens
AAH39299 1.2e-182 99.2 STIP1 protein [...
 Homo sapiens
Q4R8N7 2.9e-182 99.0 Stress-induced-...
 Macaca fascicularis
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001440 4 37 PF00515 Tetratricopeptide TPR_1
IPR001440 38 60 PF00515 Tetratricopeptide TPR_1
IPR001440 72 105 PF00515 Tetratricopeptide TPR_1
IPR013105 225 258 PF07719 Tetratricopeptide TPR_2
IPR001440 259 292 PF00515 Tetratricopeptide TPR_1
IPR001440 300 333 PF00515 Tetratricopeptide TPR_1
IPR001440 360 393 PF00515 Tetratricopeptide TPR_1
IPR001440 394 427 PF00515 Tetratricopeptide TPR_1
IPR001440 428 461 PF00515 Tetratricopeptide TPR_1
HMMSmart IPR013026 4 37 SM00028 Tetratricopeptide region
IPR013026 38 71 SM00028 Tetratricopeptide region
IPR013026 72 105 SM00028 Tetratricopeptide region
IPR006636 130 169 SM00727 Heat shock chaperonin-binding
IPR013026 225 258 SM00028 Tetratricopeptide region
IPR013026 259 292 SM00028 Tetratricopeptide region
IPR013026 300 333 SM00028 Tetratricopeptide region
IPR013026 360 393 SM00028 Tetratricopeptide region
IPR013026 394 427 SM00028 Tetratricopeptide region
IPR013026 428 461 SM00028 Tetratricopeptide region
IPR006636 492 531 SM00727 Heat shock chaperonin-binding
ProfileScan IPR013026 4 37 PS50005 Tetratricopeptide region
IPR013026 4 105 PS50293 Tetratricopeptide region
IPR013026 38 71 PS50005 Tetratricopeptide region
IPR013026 72 105 PS50005 Tetratricopeptide region
IPR013026 225 258 PS50005 Tetratricopeptide region
IPR013026 225 461 PS50293 Tetratricopeptide region
IPR013026 259 292 PS50005 Tetratricopeptide region
IPR013026 300 333 PS50005 Tetratricopeptide region
IPR013026 360 393 PS50005 Tetratricopeptide region
IPR013026 394 427 PS50005 Tetratricopeptide region
IPR013026 428 461 PS50005 Tetratricopeptide region
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp