ORK01457

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01457

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01457
Clone name	af26404
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	DLG4
cDNA sequence	DNA sequence (3065 bp) Predicted protein sequence (738 aa)
HaloTag ORF Clone	FHC01457
Flexi ORF Clone	FXC01457
Description	Discs large homolog 4 (Postsynaptic density protein 95) (PSD-95) (Synapse-associated protein 90) (SAP90).

Features of the cloned cDNA sequence

Description

Length: 3065 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	814 bp
Genome contig ID	gi51511734r_6933936
PolyA signal sequence (None)	+--------+--------+----*----+---- CTTTTGAGAGAGTGAAAGGAAGAGACAGATACTTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACTTGGTGTGTGGCCTGGTTATTTGGGACCTGGGTGTGGAGGGAGATG

Features of the protein sequence

Description

Length: 738 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
P78352	100.0	Disks large hom...	Homo sapiens
P31016	99.8	Disks large hom...	Rattus norvegicus
Q62108	99.5	Disks large hom...	Mus musculus
EAW90255	99.5	discs, large ho...	Homo sapiens
CAI35169	99.1	discs, large ho...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	446	504	PD000066	Src homology-3
FPrintScan	IPR001452	445	455	PR00452	Src homology-3
	IPR001452	464	479	PR00452	Src homology-3
	IPR001452	481	490	PR00452	Src homology-3
HMMPfam	IPR001478	79	163	PF00595	PDZ/DHR/GLGF
	IPR001478	174	258	PF00595	PDZ/DHR/GLGF
	IPR001478	327	405	PF00595	PDZ/DHR/GLGF
	IPR001452	445	489	PF00018	Src homology-3
	IPR008144	581	683	PF00625	Guanylate kinase
HMMSmart	IPR001478	87	166	SM00228	PDZ/DHR/GLGF
	IPR001478	182	261	SM00228	PDZ/DHR/GLGF
	IPR001478	335	408	SM00228	PDZ/DHR/GLGF
	IPR001452	445	511	SM00326	Src homology-3
	IPR008145	547	726	SM00072	Guanylate kinase/L-type calcium channel region
ProfileScan	IPR001478	79	166	PS50106	PDZ/DHR/GLGF
	IPR001478	174	261	PS50106	PDZ/DHR/GLGF
	IPR001478	327	408	PS50106	PDZ/DHR/GLGF
	IPR001452	442	512	PS50002	Src homology-3
	IPR008144	548	723	PS50052	Guanylate kinase
ScanRegExp	IPR008144	580	597	PS00856	Guanylate kinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp