Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01458
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01458
Clone name bm02791
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol ACO2
cDNA sequence DNA sequence (2632 bp)
Predicted protein sequence (784 aa)
Flexi ORF Clone FXC01458
Description Aconitate hydratase, mitochondrial precursor (EC 4.2.1.3) (Citrate hydro-lyase) (Aconitase).
Features of the cloned cDNA sequence

Length: 2632 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 276 bp
Genome contig ID gi89161203f_40095084
PolyA signal sequence
(None)		 
+----*----+----*----+----*----+----
ATTTATTTTTGATGACAAGACTCCCATCTAAAGTT
Flanking genome sequence
(159757 - 159806)		 
----+----*----+----*----+----*----+----*----+----*
TTTCTCCTGCCTGATCATTTCATTGGTGGCTGAAGGATTCTAGAGAACCT

Features of the protein sequence

Length: 784 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q99798 0 100.0 Aconitate hydra...
 Homo sapiens
BAG37362 0 99.8 unnamed protein...
 Homo sapiens
CAG38805 0 99.7 ACO2 [Homo sapi...
 Homo sapiens
AAH26196 0 99.7 Aconitase 2, mi...
 Homo sapiens
XP_001105023 0 98.9 similar to acon...
 Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR001030 49 556 PD000511 Aconitate hydratase
FPrintScan IPR001030 144 157 PR00415 Aconitate hydratase
IPR001030 167 175 PR00415 Aconitate hydratase
IPR001030 187 200 PR00415 Aconitate hydratase
IPR001030 201 216 PR00415 Aconitate hydratase
IPR001030 263 276 PR00415 Aconitate hydratase
IPR001030 277 290 PR00415 Aconitate hydratase
IPR001030 351 365 PR00415 Aconitate hydratase
IPR001030 385 396 PR00415 Aconitate hydratase
IPR001030 444 457 PR00415 Aconitate hydratase
HMMPfam IPR001030 68 507 PF00330 Aconitate hydratase
IPR000573 586 716 PF00694 Aconitate hydratase
HMMTigr IPR006248 49 779 TIGR01340 Aconitate hydratase
ScanRegExp IPR002155 204 217 PS00099 Thiolase
IPR001030 381 397 PS00450 Aconitate hydratase
IPR001030 444 457 PS01244 Aconitate hydratase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp