Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01460
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01460
Clone name bm05643
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol ZNF8
cDNA sequence DNA sequence (2076 bp)
Predicted protein sequence (602 aa)
Flexi ORF Clone FXC01460
Description Zinc finger protein 8 (Zinc finger protein HF.18).
Features of the cloned cDNA sequence

Length: 2076 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 266 bp
Genome contig ID gi42406306f_63382178
PolyA signal sequence
(AATATA,-28)
+----*----+----*----+----*----+----
CACAGGTAATATAACCTACCCACCTGTGTAATGTC
Flanking genome sequence
(116804 - 116853)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAATCAATATGCGGCCCCATTTTGTAAAGGATCATTAAAATGAAA

Features of the protein sequence

Length: 602 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
P17098 0 100.0 Zinc finger pro...
Homo sapiens
BAG52656 0 99.8 unnamed protein...
Homo sapiens
ABZ92246 0 99.8 zinc finger pro...
synthetic construct
XP_524437 0 99.1 zinc finger pro...
Pan troglodytes
CAH89693 0 97.3 hypothetical pr...
Pongo abelii
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 284 307 PD000003 Zinc finger
IPR007087 312 335 PD000003 Zinc finger
IPR007087 340 363 PD000003 Zinc finger
IPR007087 368 391 PD000003 Zinc finger
IPR007087 424 446 PD000003 Zinc finger
IPR007087 494 517 PD000003 Zinc finger
HMMPfam IPR001909 52 92 PF01352 KRAB box
IPR007087 284 306 PF00096 Zinc finger
IPR007087 312 334 PF00096 Zinc finger
IPR007087 340 362 PF00096 Zinc finger
IPR007087 368 390 PF00096 Zinc finger
IPR007087 396 418 PF00096 Zinc finger
IPR007087 424 446 PF00096 Zinc finger
IPR007087 494 516 PF00096 Zinc finger
HMMSmart IPR001909 52 112 SM00349 KRAB box
IPR015880 284 306 SM00355 Zinc finger
IPR015880 312 334 SM00355 Zinc finger
IPR015880 340 362 SM00355 Zinc finger
IPR015880 368 390 SM00355 Zinc finger
IPR015880 396 418 SM00355 Zinc finger
IPR015880 424 446 SM00355 Zinc finger
IPR015880 494 516 SM00355 Zinc finger
ProfileScan IPR001909 52 123 PS50805 KRAB box
IPR007087 284 311 PS50157 Zinc finger
IPR007087 312 339 PS50157 Zinc finger
IPR007087 340 367 PS50157 Zinc finger
IPR007087 368 395 PS50157 Zinc finger
IPR007087 396 423 PS50157 Zinc finger
IPR007087 424 451 PS50157 Zinc finger
IPR007087 494 521 PS50157 Zinc finger
ScanRegExp IPR007087 286 306 PS00028 Zinc finger
IPR007087 314 334 PS00028 Zinc finger
IPR007087 342 362 PS00028 Zinc finger
IPR007087 370 390 PS00028 Zinc finger
IPR007087 398 418 PS00028 Zinc finger
IPR007087 426 446 PS00028 Zinc finger
IPR007087 496 516 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp