ORK01461

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01461

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01461
Clone name	bm05962
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	DDX56
cDNA sequence	DNA sequence (1752 bp) Predicted protein sequence (558 aa)
HaloTag ORF Clone	FHC01461
Flexi ORF Clone	FXC01461
Description	Probable ATP-dependent RNA helicase DDX56 (EC 3.6.1.-) (DEAD box protein 56) (ATP-dependent 61 kDa nucleolar RNA helicase) (DEAD-box protein 21).

Features of the cloned cDNA sequence

Description

Length: 1752 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	74 bp
Genome contig ID	gi89161213r_44472052
PolyA signal sequence (None)	+--------+--------+----*----+---- ACAGGCTTACACCCTTCGTGGACAGGCGAGGCTCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GGTGCTTACTGCACAGCCTGAACAGACAGTTCTGGGGCCGGCAGTGCTGG

Features of the protein sequence

Description

Length: 558 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9NY93	100.0	Probable ATP-de...	Homo sapiens
EAW61095	99.8	DEAD (Asp-Glu-A...	Homo sapiens
BAB14238	99.8	unnamed protein...	Homo sapiens
XP_001145021	99.6	DEAD (Asp-Glu-A...	Pan troglodytes
BAD96382	99.6	DEAD (Asp-Glu-A...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011545	42	218	PF00270	DNA/RNA helicase
HMMPfam	IPR001650	357	391	PF00271	DNA/RNA helicase
HMMSmart	IPR014001	37	245	SM00487	DEAD-like helicases
HMMSmart	IPR001650	283	391	SM00490	DNA/RNA helicase
ProfileScan	IPR014014	18	46	PS51195	RNA helicase
	IPR014021	49	229	PS51192	Helicase
	IPR001650	241	435	PS51194	DNA/RNA helicase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp