Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01470
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209744
Product ID ORK01470
Clone name ej00975
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol AEBP1
cDNA sequence DNA sequence (4038 bp)
Predicted protein sequence (1172 aa)
Flexi ORF Clone FXC01470
Description adipocyte enhancer binding protein 1 precursor
Features of the cloned cDNA sequence

Length: 4038 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 302 bp
Genome contig ID gi89161213f_44010531
PolyA signal sequence
(AATAAA,-23)		 
+----*----+----*----+----*----+----
CAAGGTCACTCCAATAAAACAAGCTCATGGCACGG
Flanking genome sequence
(110158 - 110207)		 
----+----*----+----*----+----*----+----*----+----*
ACTGCTCACATTCTGAGGTGTCAGGGATGGGGAGGAGGGAGACCGGCTGG

Features of the protein sequence

Length: 1172 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92981 0 100.0 adipocyte enhan...
 Homo sapiens
BAG10892 0 100.0 adipocyte enhan...
 synthetic construct
Q8IUX7 0 99.8 Adipocyte enhan...
 Homo sapiens
AAC25585 0 99.6 aortic carboxyp...
 Homo sapiens
A2RUV9 0 83.4 Adipocyte enhan...
 Rattus norvegicus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR000834 604 616 PR00765 Peptidase M14
IPR000834 630 644 PR00765 Peptidase M14
IPR000834 774 787 PR00765 Peptidase M14
HMMPfam IPR000421 413 551 PF00754 Coagulation factor 5/8 type
IPR000834 584 910 PF00246 Peptidase M14
HMMSmart IPR000421 398 554 SM00231 Coagulation factor 5/8 type
IPR000834 578 1006 SM00631 Peptidase M14
ProfileScan IPR000421 397 554 PS50022 Coagulation factor 5/8 type
ScanRegExp IPR000421 446 475 PS01285 Coagulation factor 5/8 type
IPR000421 538 554 PS01286 Coagulation factor 5/8 type
IPR000834 630 652 PS00132 Peptidase M14
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp