Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01473
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01473
Clone name ek00083
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol PFKP
cDNA sequence DNA sequence (2499 bp)
Predicted protein sequence (795 aa)
Flexi ORF Clone FXC01473
Description 6-phosphofructokinase type C (EC 2.7.1.11) (Phosphofructokinase 1) (Phosphohexokinase) (Phosphofructo-1-kinase isozyme C) (PFK-C) (6- phosphofructokinase, platelet type).
Features of the cloned cDNA sequence

Length: 2499 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 109 bp
Genome contig ID gi89161187f_2999753
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ACTTTATGCACGTATTATTGACATTAATACCTAAT
Flanking genome sequence
(169129 - 169178)
----+----*----+----*----+----*----+----*----+----*
CGGCGAGTGCCCATCTGCCCCACCTGCTCCAGTGCGTGCTGTCTGTGGAG

Features of the protein sequence

Length: 795 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW86495 0 100.0 phosphofructoki...
Homo sapiens
Q01813 0 100.0 6-phosphofructo...
Homo sapiens
AAQ02491 0 100.0 phosphofructoki...
synthetic construct
Q5R636 0 99.4 6-phosphofructo...
Pongo abelii
XP_507625 0 99.5 phosphofructoki...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR015913 178 236 PD000707 Phosphofructokinase_core
IPR015913 541 602 PD000707 Phosphofructokinase_core
FPrintScan IPR000023 40 59 PR00476 Phosphofructokinase
IPR000023 65 78 PR00476 Phosphofructokinase
IPR000023 129 145 PR00476 Phosphofructokinase
IPR000023 179 196 PR00476 Phosphofructokinase
IPR000023 197 215 PR00476 Phosphofructokinase
IPR000023 217 233 PR00476 Phosphofructokinase
IPR000023 235 252 PR00476 Phosphofructokinase
IPR000023 274 286 PR00476 Phosphofructokinase
IPR000023 308 330 PR00476 Phosphofructokinase
HMMPfam IPR000023 36 346 PF00365 Phosphofructokinase
IPR000023 423 710 PF00365 Phosphofructokinase
HMMTigr IPR009161 36 777 TIGR02478 6-phosphofructokinase
ScanRegExp IPR015912 312 330 PS00433 Phosphofructokinase
IPR015912 676 694 PS00433 Phosphofructokinase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp